ID: 1106435954

View in Genome Browser
Species Human (GRCh38)
Location 13:29722815-29722837
Sequence CCTGTGACTCTGAGCGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106435954_1106435961 -1 Left 1106435954 13:29722815-29722837 CCTTGTCCGCTCAGAGTCACAGG No data
Right 1106435961 13:29722837-29722859 GGTGGCTCGGGCACTTGCAGAGG No data
1106435954_1106435962 0 Left 1106435954 13:29722815-29722837 CCTTGTCCGCTCAGAGTCACAGG No data
Right 1106435962 13:29722838-29722860 GTGGCTCGGGCACTTGCAGAGGG No data
1106435954_1106435963 6 Left 1106435954 13:29722815-29722837 CCTTGTCCGCTCAGAGTCACAGG No data
Right 1106435963 13:29722844-29722866 CGGGCACTTGCAGAGGGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106435954 Original CRISPR CCTGTGACTCTGAGCGGACA AGG (reversed) Intergenic
No off target data available for this crispr