ID: 1106436019

View in Genome Browser
Species Human (GRCh38)
Location 13:29723317-29723339
Sequence AAACCAGGAGTTACCATAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106436019_1106436023 13 Left 1106436019 13:29723317-29723339 CCAATTATGGTAACTCCTGGTTT No data
Right 1106436023 13:29723353-29723375 AGATGCACTTCTGGCCAATGAGG No data
1106436019_1106436025 15 Left 1106436019 13:29723317-29723339 CCAATTATGGTAACTCCTGGTTT No data
Right 1106436025 13:29723355-29723377 ATGCACTTCTGGCCAATGAGGGG No data
1106436019_1106436024 14 Left 1106436019 13:29723317-29723339 CCAATTATGGTAACTCCTGGTTT No data
Right 1106436024 13:29723354-29723376 GATGCACTTCTGGCCAATGAGGG No data
1106436019_1106436022 4 Left 1106436019 13:29723317-29723339 CCAATTATGGTAACTCCTGGTTT No data
Right 1106436022 13:29723344-29723366 ATGGTCATGAGATGCACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106436019 Original CRISPR AAACCAGGAGTTACCATAAT TGG (reversed) Intergenic
No off target data available for this crispr