ID: 1106436120

View in Genome Browser
Species Human (GRCh38)
Location 13:29724291-29724313
Sequence ATGTAGTGGCTGGTTGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106436114_1106436120 4 Left 1106436114 13:29724264-29724286 CCTCTCCGTTGTCTTGGGTTCCT No data
Right 1106436120 13:29724291-29724313 ATGTAGTGGCTGGTTGAACAAGG No data
1106436115_1106436120 -1 Left 1106436115 13:29724269-29724291 CCGTTGTCTTGGGTTCCTCACCA No data
Right 1106436120 13:29724291-29724313 ATGTAGTGGCTGGTTGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106436120 Original CRISPR ATGTAGTGGCTGGTTGAACA AGG Intergenic
No off target data available for this crispr