ID: 1106439890

View in Genome Browser
Species Human (GRCh38)
Location 13:29757020-29757042
Sequence GAGAGAGAACAGGTGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106439890_1106439898 21 Left 1106439890 13:29757020-29757042 CCCTGGTCCACCTGTTCTCTCTC No data
Right 1106439898 13:29757064-29757086 CCATGAGTAAAAGCTCCTTGAGG 0: 23
1: 297
2: 670
3: 838
4: 1482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106439890 Original CRISPR GAGAGAGAACAGGTGGACCA GGG (reversed) Intergenic
No off target data available for this crispr