ID: 1106439890 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:29757020-29757042 |
| Sequence | GAGAGAGAACAGGTGGACCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1106439890_1106439898 | 21 | Left | 1106439890 | 13:29757020-29757042 | CCCTGGTCCACCTGTTCTCTCTC | No data | ||
| Right | 1106439898 | 13:29757064-29757086 | CCATGAGTAAAAGCTCCTTGAGG | 0: 23 1: 297 2: 670 3: 838 4: 1482 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1106439890 | Original CRISPR | GAGAGAGAACAGGTGGACCA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||