ID: 1106439898

View in Genome Browser
Species Human (GRCh38)
Location 13:29757064-29757086
Sequence CCATGAGTAAAAGCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3310
Summary {0: 23, 1: 297, 2: 670, 3: 838, 4: 1482}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106439892_1106439898 14 Left 1106439892 13:29757027-29757049 CCACCTGTTCTCTCTCTTGCTAC No data
Right 1106439898 13:29757064-29757086 CCATGAGTAAAAGCTCCTTGAGG 0: 23
1: 297
2: 670
3: 838
4: 1482
1106439894_1106439898 -8 Left 1106439894 13:29757049-29757071 CCACTTCACCTTCCACCATGAGT 0: 106
1: 928
2: 1905
3: 3896
4: 5771
Right 1106439898 13:29757064-29757086 CCATGAGTAAAAGCTCCTTGAGG 0: 23
1: 297
2: 670
3: 838
4: 1482
1106439889_1106439898 22 Left 1106439889 13:29757019-29757041 CCCCTGGTCCACCTGTTCTCTCT No data
Right 1106439898 13:29757064-29757086 CCATGAGTAAAAGCTCCTTGAGG 0: 23
1: 297
2: 670
3: 838
4: 1482
1106439888_1106439898 25 Left 1106439888 13:29757016-29757038 CCTCCCCTGGTCCACCTGTTCTC No data
Right 1106439898 13:29757064-29757086 CCATGAGTAAAAGCTCCTTGAGG 0: 23
1: 297
2: 670
3: 838
4: 1482
1106439890_1106439898 21 Left 1106439890 13:29757020-29757042 CCCTGGTCCACCTGTTCTCTCTC No data
Right 1106439898 13:29757064-29757086 CCATGAGTAAAAGCTCCTTGAGG 0: 23
1: 297
2: 670
3: 838
4: 1482
1106439893_1106439898 11 Left 1106439893 13:29757030-29757052 CCTGTTCTCTCTCTTGCTACCAC No data
Right 1106439898 13:29757064-29757086 CCATGAGTAAAAGCTCCTTGAGG 0: 23
1: 297
2: 670
3: 838
4: 1482
1106439891_1106439898 20 Left 1106439891 13:29757021-29757043 CCTGGTCCACCTGTTCTCTCTCT No data
Right 1106439898 13:29757064-29757086 CCATGAGTAAAAGCTCCTTGAGG 0: 23
1: 297
2: 670
3: 838
4: 1482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106439898 Original CRISPR CCATGAGTAAAAGCTCCTTG AGG Intergenic
Too many off-targets to display for this crispr