ID: 1106441167

View in Genome Browser
Species Human (GRCh38)
Location 13:29772764-29772786
Sequence TTCTTCCAAGTCTTCATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 557}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106441167_1106441171 4 Left 1106441167 13:29772764-29772786 CCCAAAATGAAGACTTGGAAGAA 0: 1
1: 0
2: 2
3: 51
4: 557
Right 1106441171 13:29772791-29772813 AAAAAATTATATATATTTGGAGG 0: 1
1: 2
2: 28
3: 223
4: 2188
1106441167_1106441170 1 Left 1106441167 13:29772764-29772786 CCCAAAATGAAGACTTGGAAGAA 0: 1
1: 0
2: 2
3: 51
4: 557
Right 1106441170 13:29772788-29772810 CCAAAAAAATTATATATATTTGG 0: 1
1: 1
2: 5
3: 123
4: 1043

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106441167 Original CRISPR TTCTTCCAAGTCTTCATTTT GGG (reversed) Intronic
900082331 1:867358-867380 TTATCCCAAGCTTTCATTTTGGG - Intergenic
901176446 1:7302877-7302899 ATCTTCCAAATCGTCATTTTGGG + Intronic
902204855 1:14860832-14860854 TTCTTCCAATAATTTATTTTAGG - Intronic
902540067 1:17148134-17148156 TTCTCCCAAGTGTCAATTTTGGG + Intergenic
904371590 1:30051021-30051043 TTATTCCAAGTCTTCTCCTTTGG - Intergenic
904546475 1:31277635-31277657 TTCTGCCAATGCTTCATTTTCGG - Intronic
906393295 1:45437935-45437957 TACTTCCAAGTAGTCTTTTTGGG + Intronic
908371363 1:63482397-63482419 TTTTTCCAACTCTTAACTTTTGG - Intronic
909081742 1:71120988-71121010 TTCCTCCATCTCTTTATTTTGGG + Intergenic
909262258 1:73505495-73505517 TTCTTCTGGGTCTTAATTTTAGG - Intergenic
910210494 1:84787841-84787863 CTCTTCAAAGTGTTAATTTTTGG - Intergenic
910331589 1:86078663-86078685 TTTTTCCAATTGTTCATTATTGG - Intronic
910447234 1:87310927-87310949 TAATTCCTATTCTTCATTTTTGG + Intergenic
910526998 1:88190855-88190877 GTCTTTCTAGTCTTCAGTTTTGG + Intergenic
910743383 1:90546575-90546597 TTCTTCCATGTCTTTCTTTGAGG - Intergenic
910909298 1:92216885-92216907 TTATTCCTCATCTTCATTTTCGG - Intergenic
911276661 1:95868647-95868669 CTTTTCCAGGTCTTCATTCTAGG + Intergenic
913212372 1:116592265-116592287 TTCTTTCACGTCTGCATTTATGG - Intronic
913697573 1:121342386-121342408 CTCTTCAAAGTCTTCTTTCTAGG - Intronic
914139986 1:144937666-144937688 CTCTTCAAAGTCTTCTTTCTAGG + Intronic
914372594 1:147042247-147042269 TTCTTCTACCTCTTGATTTTTGG - Intergenic
914576908 1:148980521-148980543 TTCTTCTACCTCTTGATTTTTGG + Intronic
915577220 1:156787509-156787531 TTCTTCCTAACCTTTATTTTAGG + Intronic
915824192 1:159057751-159057773 TTCTCTCTAGTCCTCATTTTTGG + Intergenic
917414428 1:174793995-174794017 TTCATTCAAGTCTTGATTCTGGG - Intronic
917546633 1:175975727-175975749 TCCTTCCAAATCATTATTTTAGG - Intronic
917708707 1:177661129-177661151 TTATTTCAACTCTACATTTTTGG - Intergenic
917937140 1:179879691-179879713 TTCTTACCGGTCTTCTTTTTTGG + Intergenic
918557814 1:185825632-185825654 TTATTCAAAGTTTACATTTTAGG + Intronic
918565966 1:185932340-185932362 TTGTTTCCAGTCTTCATTCTAGG + Intronic
918610795 1:186488595-186488617 TTCTTCTCAGCCTTCATTTGTGG + Intergenic
918632342 1:186732642-186732664 TGCATCCAAAGCTTCATTTTAGG - Intergenic
919029771 1:192226687-192226709 CTCTTCCAAGTTTTCATCTTAGG - Intergenic
919328648 1:196140440-196140462 TTCTCTCTAGTCCTCATTTTTGG + Intergenic
919517314 1:198542069-198542091 TCATTCTAAGTCTCCATTTTGGG - Intergenic
920484962 1:206361035-206361057 CTCTTCAAAGTCTTCTTTCTAGG - Intronic
921404807 1:214766945-214766967 CTCTTTCCAATCTTCATTTTAGG + Intergenic
921661277 1:217806093-217806115 TTCTTCCAATTTTTCCCTTTTGG - Intronic
921775246 1:219090576-219090598 TTCTTCCCTGTATTCCTTTTTGG - Intergenic
922336020 1:224618424-224618446 TTTCTCCACGTCTTCATTTTGGG - Intronic
923144267 1:231186868-231186890 ATCATCCAAGCTTTCATTTTAGG - Intronic
923342440 1:233019282-233019304 TTTTTCCACTTCCTCATTTTTGG - Intronic
924525425 1:244843031-244843053 TTCTTCTAAGGTTTCATTGTAGG + Exonic
1063376820 10:5558978-5559000 CTCTCCCAAGTCTTCCTTATAGG + Intergenic
1063610057 10:7554237-7554259 CCCTTCCAAGTGTTCATTGTTGG - Intergenic
1064374137 10:14780277-14780299 TTCTTCCAAGTAGTCCTGTTTGG - Intergenic
1065620583 10:27576995-27577017 TTCTTAAAATACTTCATTTTAGG + Intergenic
1066363450 10:34753431-34753453 GTATTCCAAGGCTTCATTTGTGG - Intronic
1066440940 10:35437836-35437858 ACCTTCCAAGTCTTGCTTTTGGG + Intronic
1066797160 10:39135206-39135228 TTCTTCCTAGTTTTTATTTGGGG - Intergenic
1067536041 10:47110926-47110948 TTCTTTCCAGTCTTCCTTTGTGG + Intergenic
1067733206 10:48828843-48828865 TTCTTTCACGTCTTCATTTGGGG - Exonic
1068038332 10:51789608-51789630 GTCTCCTAACTCTTCATTTTAGG - Intronic
1069060491 10:63889474-63889496 TTGTTCCAATTCCACATTTTCGG + Intergenic
1069699643 10:70412881-70412903 TTTTTCTTAGTCTTCATGTTTGG - Intronic
1070141849 10:73744288-73744310 TTCTGCCACGTCTGCATTTCGGG - Intergenic
1070837689 10:79460606-79460628 TTCTTCCAAGCCTTAAATGTTGG + Intergenic
1071532193 10:86399006-86399028 TTTTTTTAACTCTTCATTTTGGG + Intergenic
1071899442 10:90103680-90103702 TTCTTTCCTGTCTTCCTTTTAGG - Intergenic
1072058189 10:91781727-91781749 TTCTTCCAATTTTTTAGTTTAGG - Intergenic
1072199147 10:93143179-93143201 TCCTTCCACGTCTGGATTTTGGG + Intergenic
1072703419 10:97661668-97661690 TTCTTAAATGTCTTCAATTTAGG + Intronic
1074205755 10:111281439-111281461 CTATTCCATGTCTTCATTTTGGG - Intergenic
1074572829 10:114640099-114640121 TCCTTCTATGTCATCATTTTTGG - Intronic
1075176907 10:120172769-120172791 TTCTTCTAATTTTGCATTTTGGG + Intergenic
1077827031 11:5821886-5821908 TTTTCCCAAGTCATCAGTTTAGG + Intronic
1078715109 11:13832417-13832439 TTCTTCCATGTCTTCACATGTGG - Intergenic
1079752012 11:24212137-24212159 GTCTTCCACGTATTAATTTTGGG - Intergenic
1079774595 11:24508558-24508580 GTCTTCCAAGTGTTAATTGTGGG + Intronic
1080175066 11:29353432-29353454 ATCTTTAAAGTCTTAATTTTTGG + Intergenic
1080197999 11:29634123-29634145 TTCTTAAAAGTATTCATTTGTGG - Intergenic
1080554858 11:33406784-33406806 TGCTTCGTATTCTTCATTTTTGG + Intergenic
1082290710 11:50366592-50366614 TTCTTTCTAGTTTTCATTTGTGG - Intergenic
1082752830 11:57039116-57039138 TTCTTGCAAGTGTACATCTTAGG + Intergenic
1083117659 11:60478557-60478579 TTCTTTCTAGTCTTCACTTTAGG + Intergenic
1084335369 11:68454674-68454696 TTCTTCCAGGTCTTTGTGTTAGG - Intergenic
1084628648 11:70330180-70330202 CTCTTCCATATCTTCCTTTTGGG - Exonic
1084862446 11:72028910-72028932 TTCTTCCAAGTGCTCACTCTTGG - Intronic
1085173781 11:74469453-74469475 TTCTCCCATTTCTTTATTTTTGG + Intergenic
1085717089 11:78881842-78881864 GTCTCCTAAGTCTTCCTTTTAGG + Intronic
1085845772 11:80062788-80062810 TTCTTCCCTGTCTTTATTATAGG - Intergenic
1085943726 11:81239994-81240016 TTCTTTCCACACTTCATTTTGGG + Intergenic
1086144772 11:83539600-83539622 TTCTGCCAAATTTTCTTTTTAGG - Intronic
1089041492 11:115454751-115454773 TCTTTCCAAGAGTTCATTTTAGG + Intronic
1089873199 11:121695168-121695190 TTCCTACAAGTCTTGATTCTCGG + Intergenic
1090488137 11:127133197-127133219 TTCTGCCCAGTCCTCATTTGTGG - Intergenic
1092620626 12:10262209-10262231 CACTTCCAATTCTTCATTATTGG + Intergenic
1092653905 12:10664738-10664760 TTTTTCTAAGTCTGCTTTTTTGG - Intronic
1093334584 12:17886958-17886980 TTCTTCAAAATCTTCACTTGGGG + Intergenic
1093535222 12:20215316-20215338 CTATTTCAAGTATTCATTTTTGG + Intergenic
1094158451 12:27363058-27363080 GCCTTCCAAGTCTTCATGCTGGG + Intronic
1094394203 12:29987989-29988011 TACATCTAAGTATTCATTTTAGG + Intergenic
1094733807 12:33209289-33209311 TTCTTCAAATTATTTATTTTTGG + Intergenic
1094827747 12:34285985-34286007 TTCTTTCTCGTTTTCATTTTGGG + Intergenic
1095081904 12:38010996-38011018 TTCCTTCAAGTTTTCATTGTAGG - Intergenic
1095084007 12:38040333-38040355 TTCTTGCTAGTTTTTATTTTGGG - Intergenic
1095084066 12:38041372-38041394 TTCTTTCTAGTTTTTATTTTGGG - Intergenic
1095754117 12:45744705-45744727 GTCTTACAAGTCTTCATTATAGG + Intronic
1097336267 12:58386824-58386846 TTCTTCCCTGTCTTCCTTTTTGG - Intergenic
1098167538 12:67713688-67713710 TTCTCTCCAGTCCTCATTTTTGG - Intergenic
1098231948 12:68380461-68380483 TTGTTCCTAGTCTGCAATTTGGG + Intergenic
1098398289 12:70045595-70045617 TTCCTCCCAGTTTTCATTCTGGG - Intergenic
1098892234 12:76021201-76021223 TTTTTTCAAGTTTTCATTTCCGG + Intergenic
1098986779 12:77020682-77020704 TTCTTCGAAGGCCTCATCTTGGG - Intergenic
1098992757 12:77082834-77082856 GTCTTCCATATATTCATTTTTGG - Intergenic
1099163114 12:79270134-79270156 TTTTTCAAAGTCTTGCTTTTGGG - Intronic
1099670922 12:85690984-85691006 TTATTGCACGACTTCATTTTTGG + Intergenic
1099692296 12:85972633-85972655 TTCTTACAACTGTGCATTTTTGG - Exonic
1100283642 12:93142419-93142441 TTATTACAAGTCTTTTTTTTAGG - Intergenic
1100322706 12:93511155-93511177 TTTTCCCATGTCTTCATTTATGG - Exonic
1100702942 12:97167104-97167126 TTCTTCCAATCCTCCATTTAGGG - Intergenic
1100920443 12:99478666-99478688 TTCTTCCAAATCTTCAAGCTTGG + Intronic
1101414316 12:104495954-104495976 TTATTCCAAGTTTTCATTCCTGG - Intronic
1101888436 12:108689746-108689768 TTCATCTAAGTTTTCATTTTAGG + Intronic
1102167968 12:110821074-110821096 TTCTTCCTCTTCTTCTTTTTCGG + Intergenic
1104308380 12:127631381-127631403 TTCTACCAAGTCCTAAGTTTGGG - Intergenic
1104482519 12:129120556-129120578 GTCTTCTAAGTCTCCAATTTAGG - Intronic
1104707385 12:130957671-130957693 TTCTTCCAAGTCTGGATTTAGGG + Intronic
1105215617 13:18282888-18282910 TTCTTTCACGTCTGCATTTATGG - Intergenic
1106104300 13:26720946-26720968 TTTTTCTAAGTCATTATTTTTGG - Intergenic
1106268176 13:28128500-28128522 TGCTTACAAGTCTTCAATTTTGG - Intergenic
1106441167 13:29772764-29772786 TTCTTCCAAGTCTTCATTTTGGG - Intronic
1107305041 13:39009145-39009167 ATCTTCATAATCTTCATTTTTGG + Intergenic
1107387028 13:39922248-39922270 TTCTTCCAATTCATCAGCTTGGG + Intergenic
1107839924 13:44446718-44446740 TTCTTCCCAGTCTGCTATTTAGG - Intronic
1108439527 13:50436549-50436571 ATCTTCCAAGTAGTCATTTATGG + Intronic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1108510977 13:51155765-51155787 TACTTCCAAGTCTTGACTTCTGG + Intergenic
1109209228 13:59515326-59515348 TTCTCTCCAGTTTTCATTTTTGG - Intergenic
1109534349 13:63696910-63696932 TGCTTCCAAGTCTATGTTTTTGG - Intergenic
1109925007 13:69125600-69125622 TTCTTATAAGTCATGATTTTTGG - Intergenic
1110874866 13:80496261-80496283 TTCTTCAAGATCTTCATTTCAGG - Intergenic
1110952871 13:81517621-81517643 TTCTCTCCAGTCCTCATTTTTGG + Intergenic
1110956903 13:81564247-81564269 TACTTCCAGGTTTTAATTTTTGG + Intergenic
1111156002 13:84326995-84327017 TTCTTCCCAGTGTCCAGTTTTGG + Intergenic
1111226311 13:85276400-85276422 ATTTTCCAAATGTTCATTTTAGG - Intergenic
1111477274 13:88767301-88767323 TTGTTCCAACTATTAATTTTTGG - Intergenic
1111698493 13:91656735-91656757 TTCTTTGAAGTATTAATTTTTGG + Intronic
1112520793 13:100093341-100093363 TTCTTCCAAATCCTAATTTAGGG - Intronic
1113059546 13:106307359-106307381 ATCTTCAAAGACTTCTTTTTTGG - Intergenic
1113653273 13:112053180-112053202 TCATACCAACTCTTCATTTTGGG - Intergenic
1114782773 14:25557271-25557293 TTCTTCAAAGTAACCATTTTGGG - Intergenic
1114924691 14:27381177-27381199 TGCTTTCAAATCTTCTTTTTTGG - Intergenic
1116369820 14:44116041-44116063 TTATCCCAAGTGTTCATCTTTGG - Intergenic
1116586101 14:46706740-46706762 TTAATCTAAGTCTTCATTCTTGG + Intergenic
1116718309 14:48456734-48456756 TTATTCCAATTCATCATTTCTGG - Intergenic
1116867700 14:50044575-50044597 TCCTTCCATTTCTTCATGTTAGG - Intergenic
1117587967 14:57232201-57232223 TTCTTCAGTGTCTTCATTTTGGG - Intronic
1117750184 14:58913805-58913827 TTCTACCTAATCTTCATTCTGGG - Intergenic
1117834595 14:59790121-59790143 TTCTTCTAAGTCATTATTTCAGG - Intronic
1117834638 14:59790887-59790909 TTCTTCCAAGTCATTATTTCAGG + Intronic
1118338410 14:64874767-64874789 ATTTTCAAAGTATTCATTTTCGG + Intronic
1118771267 14:68944163-68944185 TTCTTCCAGGTCTCAGTTTTAGG + Intronic
1118837383 14:69486437-69486459 TTGCTCCAAGCCTTCATTTAGGG - Intronic
1118915875 14:70104917-70104939 TTCTTCCTTCTCTTCACTTTGGG - Intronic
1119476529 14:74933586-74933608 TTCTTCCCTGTCTTCATCCTTGG + Intergenic
1119548631 14:75492144-75492166 TGTTTCTAAGTCTTTATTTTGGG + Intergenic
1119853284 14:77881418-77881440 TTCTTCCATGTGTTCTTTGTTGG + Intronic
1120012363 14:79431420-79431442 CTCTTAAAAGACTTCATTTTGGG - Intronic
1120185429 14:81388922-81388944 TTCTTCCTAGTTTTAATTTCTGG - Intronic
1120261491 14:82190558-82190580 CTCTTTCAAGTCATCATTATGGG - Intergenic
1120548048 14:85834102-85834124 TGCTTCCAAGTAGTCATTTATGG - Intergenic
1121314216 14:92951620-92951642 TTCTTCCAATTCCTCATGCTGGG + Intronic
1121474494 14:94184723-94184745 TTCTTCATAGTCATCACTTTTGG + Intronic
1121594980 14:95155849-95155871 TTATTTCAAAACTTCATTTTAGG - Intronic
1122001732 14:98662853-98662875 TTCTTTCATGGCTTGATTTTGGG - Intergenic
1122148848 14:99712496-99712518 TTCTTCCATGAGTTCATTATTGG - Intronic
1122932410 14:104940344-104940366 CTCTTAGAAGCCTTCATTTTGGG + Exonic
1123580054 15:21706801-21706823 TACTTCCACTTCTACATTTTGGG - Intergenic
1123616702 15:22149423-22149445 TACTTCCACTTCTACATTTTGGG - Intergenic
1124258097 15:28162332-28162354 TTCTTCCAAGTTTTCGTCTAAGG - Intronic
1125348644 15:38744472-38744494 TTCTTTCACGTCTTTATGTTTGG - Intergenic
1125445308 15:39748158-39748180 TTCTTCCAGTTCTTCTTTTTTGG + Intronic
1125532936 15:40425467-40425489 TTCTTCCATATCTTGCTTTTTGG + Intronic
1125633112 15:41164491-41164513 TTTTTTAAAGACTTCATTTTTGG - Intergenic
1126203662 15:46018454-46018476 TTCTTGCAAGTGTGCACTTTTGG - Intergenic
1126228376 15:46296991-46297013 TTTTGCCAATTCTGCATTTTTGG + Intergenic
1127699350 15:61482657-61482679 TTGTTCCAATTCTTAACTTTTGG - Intergenic
1127975460 15:63993762-63993784 TTGGTCCAATCCTTCATTTTTGG - Intronic
1128137121 15:65272110-65272132 TACTCCCAAGTTTTCACTTTTGG + Intronic
1128384986 15:67141286-67141308 TGTTTCCTAGTCTACATTTTGGG + Intronic
1128774701 15:70311236-70311258 TTTTCCACAGTCTTCATTTTGGG + Intergenic
1129011800 15:72425864-72425886 TGCTTTCAAGACTTTATTTTTGG + Intergenic
1129290913 15:74566683-74566705 TGGTTCCAAATCTTCATTGTAGG + Intronic
1130362468 15:83203665-83203687 TTTTTTAAAGTCTTAATTTTTGG - Intronic
1130817819 15:87458232-87458254 TTCTTCTTAGTCTTTTTTTTTGG + Intergenic
1131371587 15:91886339-91886361 TTCCTTCAAGTCCTCCTTTTAGG + Intronic
1131575307 15:93583967-93583989 TTCTTTTAAGGCTTCATTTCAGG - Intergenic
1131913351 15:97233595-97233617 TTGTTTCATTTCTTCATTTTTGG - Intergenic
1132203240 15:99969421-99969443 ATCTTCCAAGTGAACATTTTGGG - Intergenic
1202988924 15_KI270727v1_random:441046-441068 TACTTCCACTTCTACATTTTGGG - Intergenic
1132695135 16:1198683-1198705 TTCTTCGTCTTCTTCATTTTCGG + Exonic
1133855765 16:9547843-9547865 TTCTTCCAAGTCTCTGTTCTCGG + Intergenic
1134070548 16:11257019-11257041 GCCTTCCCCGTCTTCATTTTGGG + Intronic
1136742593 16:32551471-32551493 TTCTTCCTAGTTTTTATCTTGGG - Intergenic
1136744428 16:32572206-32572228 TTCTTTCTAGTTTTTATTTTGGG - Intergenic
1137853969 16:51774596-51774618 TTCTTCTTAGTCATAATTTTTGG - Intergenic
1138282468 16:55782388-55782410 TTGATCCATGTCTTAATTTTAGG - Intergenic
1138286477 16:55814233-55814255 TTGATCCATGTCTTAATTTTAGG + Intronic
1138740773 16:59307159-59307181 TTCTTTCAAGTCTATATTCTTGG + Intergenic
1138762196 16:59558319-59558341 TTCTTCCATGTCTAAATTTGAGG - Intergenic
1138844657 16:60550999-60551021 TTTTTCCAATTCTTCACTCTTGG + Intergenic
1139093527 16:63677378-63677400 TCTTACCAAGTCTTAATTTTAGG - Intergenic
1140141455 16:72262005-72262027 TTCTTCAAATTCTTCAATGTTGG + Intergenic
1141809502 16:86365493-86365515 TTCTTCCATGTCTTGATTTGGGG + Intergenic
1142455993 16:90223539-90223561 TTATCCCAAGCTTTCATTTTGGG + Intergenic
1203025169 16_KI270728v1_random:503026-503048 TTCTTTCTAGTTTTTATTTTGGG + Intergenic
1203027005 16_KI270728v1_random:523757-523779 TTCTTCCTAGTTTTTATCTTGGG + Intergenic
1203044716 16_KI270728v1_random:810674-810696 TTCTTCCTAGTTTTTATCTTGGG - Intergenic
1203046552 16_KI270728v1_random:831405-831427 TTCTTTCTAGTTTTTATTTTGGG - Intergenic
1143275047 17:5704055-5704077 GTCTTCCAAGTCTCCATTCAGGG + Intergenic
1146250319 17:31335547-31335569 TTCTTCAAAGTAATCATTTAAGG + Intronic
1146446839 17:32939082-32939104 TTATTCCAGTTCTTCTTTTTTGG - Intronic
1148203508 17:45765552-45765574 TTCTCCCAAGTCTTCCTCATGGG + Intergenic
1148503987 17:48113072-48113094 TTCTTCTAAGTCTTCTGTCTCGG - Intronic
1149437558 17:56645978-56646000 TTCATTGAAGACTTCATTTTAGG - Intergenic
1150141833 17:62736866-62736888 TTCTTCAAAATTTTTATTTTTGG + Exonic
1150921427 17:69487809-69487831 TTCTCACAAGTCTTCATTATTGG - Intronic
1150927191 17:69545229-69545251 TCCTTCAAAGTAGTCATTTTGGG - Intergenic
1151273905 17:73018665-73018687 TACTCCCAAGTCTTGGTTTTAGG - Intronic
1151291588 17:73154683-73154705 TGGTGTCAAGTCTTCATTTTGGG + Intergenic
1151647833 17:75445694-75445716 CTCTTCCAATTCTAAATTTTTGG + Intronic
1151796098 17:76346941-76346963 TTCTTCCAAGTCCTGCATTTTGG - Intronic
1153109894 18:1573673-1573695 TTCTGCCAAATCTTGATTTTTGG + Intergenic
1153176413 18:2378755-2378777 TTATAGCAAGTCTTTATTTTAGG - Intergenic
1153357193 18:4150133-4150155 TGCTTCCAACTCTTGATCTTTGG + Intronic
1153482412 18:5560758-5560780 AACTTCCAAGGCTTTATTTTGGG + Intronic
1153596576 18:6731577-6731599 TTGTTCCAAGTTTGCATTTTTGG + Intronic
1153703857 18:7725168-7725190 TTCTTCTAAGTGTTGATATTTGG + Intronic
1153893902 18:9541972-9541994 TTCTACCATGTCTTTCTTTTAGG - Intergenic
1155886002 18:31208932-31208954 TTTTAACAAGTATTCATTTTAGG - Intergenic
1155893197 18:31291788-31291810 TTCCTCCATTTCTTTATTTTAGG + Intergenic
1155900872 18:31388632-31388654 TTCCTTCAAGTCTTCTATTTGGG - Intronic
1156808555 18:41218582-41218604 TTCTCTCTAGTCTTTATTTTAGG - Intergenic
1156941872 18:42777442-42777464 TGCTTCTAAGTCTTCTTTGTTGG - Intronic
1157002203 18:43540548-43540570 TCCTTCCAAGTCTCCAGGTTGGG - Intergenic
1157384940 18:47252524-47252546 CTCATCCTAGTCTTTATTTTAGG - Intergenic
1158324529 18:56299763-56299785 TTTTTCAAAGTTTGCATTTTTGG - Intergenic
1158668413 18:59453420-59453442 TTCTGCCTAGTCTTCCTATTAGG + Intronic
1159303248 18:66605816-66605838 TACTTCCAAGTCTTCATTCTTGG - Intergenic
1159494365 18:69181406-69181428 TTCTTTAAAGTGTTCTTTTTGGG - Intergenic
1159683621 18:71387875-71387897 TTGTTCAAAATCTTCATTTGTGG + Intergenic
1159863375 18:73675376-73675398 TTCACCCATGTCTTCATCTTTGG + Intergenic
1160055377 18:75474039-75474061 TTCTCCCAAAACTTCATTTTTGG + Intergenic
1160139837 18:76311622-76311644 TTCTTTCAATTCTTCAGTGTGGG - Intergenic
1161246140 19:3253256-3253278 TTGTTTGAAGTCTTTATTTTGGG - Intronic
1162224853 19:9212508-9212530 TTGTTCCAACTCTTGATTTCCGG - Intergenic
1162611557 19:11758848-11758870 TTCTTCTGGGTCTACATTTTAGG - Intergenic
1164719293 19:30420458-30420480 TTCTTCAAAGTCTGCAATGTGGG + Intronic
1164995092 19:32715378-32715400 TCCTTCCAAGAATTCCTTTTGGG + Intergenic
1165002247 19:32774468-32774490 TTTTTAAAAGTATTCATTTTAGG + Intronic
1165631713 19:37306867-37306889 TTCTTGCACGTCGTCCTTTTTGG + Intergenic
1165780124 19:38427896-38427918 TTCTTCCATGTTATCATATTTGG + Intergenic
1168107501 19:54173599-54173621 TCCTTCCAAGTCTGCAATATTGG + Exonic
1168536585 19:57175407-57175429 TTATCCCAAGTTTTCTTTTTTGG - Intergenic
925113732 2:1359521-1359543 TTATTCCATCTCTTCACTTTTGG + Intronic
925540520 2:4961423-4961445 CTCTTCCAAGCCTGCATTGTAGG - Intergenic
926586974 2:14697217-14697239 TTCTTCCAATTCTTCAAACTGGG - Intergenic
926874825 2:17464187-17464209 TTCTGCTAGGTGTTCATTTTGGG - Intergenic
928639832 2:33286463-33286485 CTGTACCAAGTCTTCAATTTTGG - Intronic
930259723 2:49131106-49131128 TTTTTCTAACTCTTCATTTAAGG - Intronic
930347113 2:50197389-50197411 TAATCCAAAGTCTTCATTTTAGG - Intronic
930381263 2:50633046-50633068 TTCTAACAAGTCATCATTATTGG + Intronic
930471918 2:51827330-51827352 TTCTTGTTACTCTTCATTTTGGG - Intergenic
930563942 2:52996183-52996205 TTCTTCCATGACTTGCTTTTGGG + Intergenic
930901011 2:56507824-56507846 TTCTTCCATGCCTTCGTTTGTGG + Intergenic
930949620 2:57124105-57124127 TTCTGACAAGTCTACATTATTGG + Intergenic
931466691 2:62494701-62494723 TTTTTAAAAGTCTACATTTTTGG + Intergenic
932114100 2:69030031-69030053 TTCTTCCAAGTCCACCTTCTGGG + Intronic
932208656 2:69908195-69908217 CTCTGCCCAGTCTTCTTTTTTGG + Intronic
932469567 2:71945055-71945077 TTCTTCCAATTCTTTCTCTTTGG - Intergenic
933228255 2:79775886-79775908 TTCTTCCGACTCTTAATATTAGG + Intronic
933395137 2:81721862-81721884 ATCTTCCCAGTGCTCATTTTTGG + Intergenic
934298714 2:91763837-91763859 TTCTTTCACGTCTGCATTTATGG + Intergenic
934456586 2:94171265-94171287 TTCTGCCAAGTTTTCATTCGAGG - Intergenic
934456726 2:94173318-94173340 TTCTGCCAAGTTTTCATTCGAGG - Intergenic
934684765 2:96312888-96312910 CCCTTCCAGGTCTTCACTTTAGG + Intergenic
935321735 2:101896112-101896134 TTCTTCCAGGTCTTCCTTCCAGG + Intergenic
935529406 2:104214510-104214532 TTCTCTCTAGTCCTCATTTTTGG - Intergenic
935541671 2:104355671-104355693 CTCTTCCAAGTATACAATTTTGG + Intergenic
937470562 2:122170658-122170680 TTCTTCCAGGTCTTCATGCAAGG - Intergenic
937946417 2:127342138-127342160 TTCTTTCAACTTTTTATTTTGGG - Intronic
938053647 2:128197114-128197136 TTCTGCTAAGCCTTCATTTTAGG - Intergenic
938592200 2:132750504-132750526 TACTCCCAAGTCTTCACATTTGG - Intronic
939057956 2:137385389-137385411 TTCTTGCTATGCTTCATTTTTGG + Intronic
939284407 2:140110471-140110493 TTCTTCTAAGTCTTTCTCTTTGG + Intergenic
939732434 2:145801079-145801101 TTCTTCCAAGACTTGCTTTGTGG + Intergenic
940118900 2:150240612-150240634 TGTTTCCAACTCTGCATTTTGGG + Intergenic
940239057 2:151543518-151543540 TTAGTCCAACTCTTCAGTTTAGG + Intronic
940801774 2:158140706-158140728 TTTTTCCAGTTATTCATTTTAGG - Intergenic
941130196 2:161638737-161638759 TTCTTCCAAATCATCATCATGGG + Intronic
941210166 2:162628214-162628236 TTTTTCCATGTGTTCATTTTAGG - Intronic
941271985 2:163441757-163441779 TCCTTCCATGTCTTCAGATTGGG - Intergenic
942622119 2:177856198-177856220 TTCTTTGAAGTCTGTATTTTTGG - Intronic
942735501 2:179106791-179106813 TTGTTCCCAGTCCTCATTGTTGG - Exonic
942926537 2:181439794-181439816 TTCTTACAACTCTACACTTTCGG + Intergenic
942941595 2:181625096-181625118 TTTTTCCCAGTCTCCATTCTTGG - Intronic
943324633 2:186483618-186483640 TTCTTCCAAGGCTTCTCTCTTGG + Intergenic
944032360 2:195250858-195250880 TTCATCCAATTCCACATTTTAGG - Intergenic
945047105 2:205791217-205791239 TTCTTTTAAGCCTTGATTTTTGG + Intronic
945211350 2:207386422-207386444 TTCTTTGAAGTCTTGGTTTTTGG + Intergenic
945821519 2:214671355-214671377 TTCTTTCAAGCCTTCAATTAAGG - Intergenic
945956989 2:216095709-216095731 TTCTTGCAATACTTTATTTTGGG - Intronic
946995510 2:225386488-225386510 TTCTTCCAGGTCTTCTCTCTGGG + Intergenic
947024611 2:225723038-225723060 TTCTTCCAAATCTCTAATTTAGG - Intergenic
947229527 2:227871347-227871369 TTCCTCCCAGCCTTCCTTTTGGG + Intronic
949087491 2:242168340-242168362 TTATCCCAAGCTTTCATTTTGGG + Intergenic
1169805207 20:9552143-9552165 ATCTTCCAAGTTTTGATTTGTGG + Intronic
1170097205 20:12659217-12659239 TTATTCCATGTGTTTATTTTAGG - Intergenic
1170139117 20:13107648-13107670 TTCTTCCAATTCTTCTTTCACGG + Intronic
1171157865 20:22892907-22892929 TTCATCCACATCTCCATTTTGGG + Intergenic
1173205077 20:40986398-40986420 TTCTTCCAAATCTTAATAATAGG + Intergenic
1174281510 20:49443062-49443084 TTCTTGCACGTCTTTATATTAGG - Intronic
1174937517 20:54887355-54887377 TTCTTCACAGTCTTCATTCCAGG - Intergenic
1176211008 20:63921637-63921659 TTATTCGCAGTCTTCATTTCTGG - Intronic
1177097780 21:16859583-16859605 TTATTCTAAGTTTTCATTATAGG - Intergenic
1177620251 21:23581791-23581813 TTCTTTCTAGATTTCATTTTTGG - Intergenic
1177844646 21:26274752-26274774 TTTTTCCATCCCTTCATTTTTGG - Intergenic
1178205641 21:30461455-30461477 TTCTCACAACTCTTCATATTAGG + Intergenic
1178630715 21:34258941-34258963 TTCTCCCAAGTTTTAATCTTGGG - Intergenic
1181577033 22:23801768-23801790 ATCTTCAAAGTCTCCTTTTTTGG + Intronic
1181837319 22:25621564-25621586 TTCTCTCCAGTCCTCATTTTTGG + Intronic
1182927732 22:34141941-34141963 CTGTTCAAAGTGTTCATTTTTGG + Intergenic
1183756277 22:39769266-39769288 TGCATCCAAGTCTGCCTTTTGGG - Intronic
1183756445 22:39770750-39770772 TGCATCCAAGTCTGCCTTTTGGG - Intronic
1184556884 22:45238224-45238246 TTCTTAGAAGGCCTCATTTTTGG - Intronic
949272999 3:2242440-2242462 TTCTTCCAACTTTCCATTTCAGG + Intronic
950689314 3:14643036-14643058 TTCTTCCAGGTATTCAGTTATGG + Intergenic
951126758 3:18994063-18994085 CTCTTCCAAATCTTCCTTTTTGG - Intergenic
951599075 3:24352762-24352784 TTCTTCCAAGTCTTTTTCTATGG - Intronic
951686039 3:25345955-25345977 TTCTACAAAGTCTGCAGTTTGGG + Intronic
952167448 3:30766198-30766220 TTCTACCACCTCTTCATTCTTGG - Intronic
952506568 3:34011956-34011978 TCCTTCCAACTCATCATTCTTGG + Intergenic
952746385 3:36785543-36785565 TTCTTCCTATTCTGAATTTTAGG - Intergenic
953137826 3:40198680-40198702 TTCCTCCAATGTTTCATTTTTGG + Intronic
954816577 3:53286816-53286838 TCCTATCAAATCTTCATTTTAGG - Exonic
955756371 3:62228840-62228862 AGCTTCCAAGTCATTATTTTTGG + Intronic
955869942 3:63427060-63427082 GTCTTCCAAGTTTGAATTTTAGG - Intronic
955927799 3:64024555-64024577 TTCATCCAAGTTTTTATATTAGG - Intergenic
956208723 3:66780851-66780873 GTCTACAAAGTCTTCATTATTGG - Intergenic
957538359 3:81534989-81535011 TTATTCCTAAGCTTCATTTTGGG - Intronic
958057674 3:88434099-88434121 TGCCCCCAAGTCTACATTTTAGG - Intergenic
958458232 3:94360223-94360245 TTCTTTTAAGTCTTCATCTCTGG - Intergenic
958657756 3:97024502-97024524 TTATTCAAATTCTTCATGTTTGG - Intronic
958671959 3:97217573-97217595 TTCTTATACCTCTTCATTTTAGG - Intronic
959112993 3:102144212-102144234 TGCTTCCAAGCCTGGATTTTCGG - Intronic
959526017 3:107378230-107378252 TTCTTCAGAGTTTTCATTTGGGG - Exonic
959559644 3:107765082-107765104 TTGCTCTAAGTGTTCATTTTAGG - Intronic
960537089 3:118826377-118826399 TTCTTCCACATATTCATCTTTGG - Intergenic
961367835 3:126412624-126412646 TTCAACCAACTCTGCATTTTTGG + Intronic
961689315 3:128657126-128657148 TTTTTGAAAGTCTTCTTTTTTGG + Intronic
962454188 3:135549945-135549967 TTCTTTCTAGTCTTCTTTTGAGG - Intergenic
962997511 3:140645815-140645837 TTCCTCCATCCCTTCATTTTGGG + Intergenic
963151240 3:142047631-142047653 TGCCTCCATTTCTTCATTTTAGG + Intronic
963287702 3:143451310-143451332 TTCTTCCAAGTGATCCTTTTTGG + Intronic
963943051 3:151114681-151114703 TTCTTTCAGGTCTGTATTTTAGG + Intronic
964306050 3:155341225-155341247 TCCTTCCAATTCTTCATGATTGG - Intergenic
964539408 3:157762426-157762448 ATGATCCAAGTATTCATTTTGGG + Intergenic
964731219 3:159867330-159867352 TTCTTCCATGTCTGCATGTGAGG + Intronic
965849351 3:173004548-173004570 TTATTCCAAGTCTATGTTTTTGG - Intronic
966359289 3:179117349-179117371 TCTTTCCAAGTCAACATTTTGGG + Intergenic
966385821 3:179396861-179396883 TTCTTTCCATTGTTCATTTTGGG - Intergenic
967358905 3:188607605-188607627 TGCTTCCAAGCATTTATTTTTGG + Intronic
967459743 3:189731848-189731870 ATCTTCCAAGTCTTTACCTTTGG - Intronic
967557202 3:190874523-190874545 TGCTTCCAAATCTGCAGTTTGGG + Intronic
968374179 4:24243-24265 TTATCCCAAGCCTTCATTTTGGG - Intergenic
969431916 4:7160394-7160416 TTCTTCCAGATCTTCAAATTGGG - Intergenic
969590728 4:8120478-8120500 TTCTCCCGCGTCTTCATGTTGGG - Intronic
970848401 4:20571584-20571606 TTCATCCAAGTCTGCAGTTAAGG + Intronic
972086781 4:35227570-35227592 TTCTTATGAGTTTTCATTTTTGG - Intergenic
974110262 4:57517457-57517479 TTTTTCCATTTCTTCACTTTCGG - Intergenic
974129135 4:57731209-57731231 TTCTACCCTGTCTTCCTTTTGGG - Intergenic
974419335 4:61651995-61652017 TTAATCTAATTCTTCATTTTTGG - Intronic
975065494 4:70057813-70057835 TTCTTCAAAGATTTCATTTTAGG - Intronic
975730297 4:77331277-77331299 TTCTGTCCAGTCCTCATTTTTGG + Intronic
976027538 4:80708223-80708245 TTCAACCAATTCTTCCTTTTGGG + Intronic
976652916 4:87455341-87455363 TTCTTCTAAGTTTTCATACTAGG - Intronic
977752157 4:100622197-100622219 TTCTCTCTAGTCGTCATTTTTGG + Intronic
978217603 4:106224609-106224631 TTCTTCAAAGTGTTTATTTTAGG - Intronic
978841017 4:113212235-113212257 TTTTTCAAAGTTTTCATATTTGG + Intronic
979157937 4:117421501-117421523 TTTCTCCAAGTGTTCTTTTTTGG + Intergenic
979389463 4:120110662-120110684 TTCTGCCAAGATTTCATATTTGG - Intergenic
979986383 4:127320855-127320877 ATCATCCAAGTCTTAATTATGGG + Intergenic
980603180 4:135052803-135052825 TACTTGCCAGTCTTTATTTTAGG + Intergenic
980640528 4:135572146-135572168 TTTTTCTTAGTCTTCATTTGTGG - Intergenic
980711285 4:136571986-136572008 TTATTCCAACTCTTCATTGTAGG - Intergenic
981598646 4:146457720-146457742 TTCATCTAAGTTTTCATATTTGG - Intronic
981761212 4:148197063-148197085 TTCTTCCAACTCTACCTTTTTGG - Intronic
981787096 4:148491773-148491795 TTCTTCCAATTCCTCAGGTTGGG + Intergenic
981978524 4:150762209-150762231 TTCTTTCTTCTCTTCATTTTGGG - Intronic
982389647 4:154850512-154850534 TTCTTCTAATTCTGCAATTTAGG - Intergenic
982666263 4:158268395-158268417 TTGTTCCACATCTTCATTCTGGG + Intergenic
982688521 4:158521995-158522017 TTCTTCTACATCTTAATTTTTGG + Exonic
982974220 4:162032934-162032956 CTCTTCTTAGTCTACATTTTGGG - Intronic
983041371 4:162931539-162931561 CTCTTCCAACTCTTCATTTCTGG + Intergenic
983554117 4:169044873-169044895 TGCTTCCAAATCTGCAATTTGGG + Intergenic
983918109 4:173314154-173314176 TTCTCCCCAGTCAACATTTTTGG - Exonic
983927217 4:173415100-173415122 TTCTGCCAACTCTCCAATTTGGG - Intergenic
984036577 4:174676085-174676107 TTCTTCTTAGACGTCATTTTAGG + Intronic
984410793 4:179395501-179395523 TTCTTACTTTTCTTCATTTTAGG - Intergenic
984603694 4:181758898-181758920 TTCTACCAAGTTTCTATTTTAGG + Intergenic
984611593 4:181845717-181845739 CTCTTACAAGTCTTGTTTTTAGG - Intergenic
984727922 4:183039281-183039303 TTTTTTAAAGCCTTCATTTTTGG - Intergenic
985460551 4:190102020-190102042 TTATCCCAAGCCTTCATTTTGGG + Intergenic
985527316 5:413278-413300 TTCTTGCACTTTTTCATTTTGGG + Intronic
985974389 5:3404501-3404523 TTTTTTCAAATATTCATTTTTGG + Intergenic
986176745 5:5359039-5359061 TTATTTCAGGTTTTCATTTTCGG - Intergenic
987123527 5:14790344-14790366 CTCTTTTAATTCTTCATTTTTGG - Intronic
987496044 5:18645990-18646012 TTTTTCTAATTTTTCATTTTTGG + Intergenic
987943895 5:24579000-24579022 TTCTTCCAGATCTTCAAATTTGG + Intronic
988085455 5:26469699-26469721 TTCTTCCAGGTTTTCCCTTTTGG + Intergenic
988775787 5:34477163-34477185 TGCTTCCAAGTCTGAATTTAGGG - Intergenic
989428065 5:41318882-41318904 TTTTTCCAACCCTTTATTTTCGG - Intronic
989474046 5:41853989-41854011 TCCATCCAAATCTTCATTTTGGG - Intronic
990442097 5:55856862-55856884 TTCCTCAAAGTCTTCTGTTTAGG + Intronic
990778224 5:59328056-59328078 TTCTTCTTAGTCTTCACTTTTGG - Intronic
991524152 5:67537733-67537755 TTCTTCCAAGTCTCTAATTCTGG - Intergenic
991627537 5:68619595-68619617 TTCTCTTAAGTGTTCATTTTAGG - Intergenic
992415629 5:76550197-76550219 TCCTTCCAAGTTTTCCCTTTTGG - Intronic
992586768 5:78248953-78248975 TACTTTCAAGACTTTATTTTTGG + Intronic
992819543 5:80482458-80482480 TTCTTCCAATTGTTCTTTCTGGG - Intergenic
992981075 5:82173135-82173157 CTCTCTCTAGTCTTCATTTTAGG + Intronic
993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG + Intergenic
993842976 5:92903227-92903249 TTCTTCAAAGTCATTATCTTAGG - Intergenic
993975425 5:94474127-94474149 TTCTTTTAATTCTTCATTCTTGG - Intronic
994056021 5:95416639-95416661 TCCTTCCAAGTATTCCATTTAGG + Intronic
995008804 5:107234196-107234218 TACTTCCAAATCTTTAATTTTGG + Intergenic
995274930 5:110267295-110267317 TTGTACCAAATCTTCATTTTGGG - Intergenic
995358698 5:111269082-111269104 TTCTTCCAAGTTATCATTATTGG - Intronic
995609704 5:113896445-113896467 TTCTTCCAAATCCTCATGGTAGG + Intergenic
996300252 5:121973365-121973387 TTCTTCCCCTTCTTCACTTTAGG - Intronic
996405849 5:123101339-123101361 GGCTTCCACGTCCTCATTTTGGG - Intronic
996906237 5:128604147-128604169 TTCCTCCATGTCTTTCTTTTAGG + Intronic
997005275 5:129809574-129809596 TTCTTCCAAGTTTCTCTTTTTGG + Intergenic
997046563 5:130326108-130326130 TTCTGTCAAATCTACATTTTAGG - Intergenic
998084063 5:139301620-139301642 TTCTTTCAAGGCTCCATTCTGGG - Intronic
998345392 5:141457571-141457593 TTCTCTCCAGTCCTCATTTTTGG + Intronic
998952099 5:147402678-147402700 TTTTACCAAGTCATCATGTTAGG - Intronic
998975148 5:147636986-147637008 CGCTTCCAGGTCTTCAATTTTGG + Exonic
999325654 5:150641773-150641795 TTCTTCCACTTCTTCCTTTCAGG - Intronic
999581352 5:153041829-153041851 TGGTTCCAAGTCTTTGTTTTTGG + Intergenic
1000038969 5:157470914-157470936 TTCTTCCAACTCTTCTGTTTGGG + Intronic
1000882083 5:166710020-166710042 TTCTCCCAAGACTACATTTCTGG - Intergenic
1001903292 5:175449262-175449284 TTCTTCCAAGTCTTCTTAAATGG + Intergenic
1002053154 5:176583419-176583441 GTCTTCCAAATGTTCATTCTAGG + Intronic
1002755112 6:151574-151596 TTATTCCAAGCCTTCATTTTGGG - Intergenic
1003160780 6:3632456-3632478 TTTGTTCAAGTCTTCCTTTTTGG - Intergenic
1003512812 6:6795634-6795656 ATTTTGCAAGTCTTCATTGTAGG - Intergenic
1004032817 6:11888169-11888191 GTCTTCCTATTATTCATTTTTGG - Intergenic
1004797762 6:19107254-19107276 TTCTTCCATCTTTTCAATTTTGG - Intergenic
1005519135 6:26583323-26583345 TTCTTCCTAGTCTTCTTTACTGG + Intergenic
1006050373 6:31337567-31337589 CTCTTCAAAGTTTTCCTTTTTGG - Intronic
1006570316 6:34997923-34997945 TTCTTCCAATTCTGCAATATTGG + Intronic
1008149885 6:47937788-47937810 TTCTTCCAAGTCTCCATTGCAGG - Intronic
1008422190 6:51314360-51314382 CTTTGCTAAGTCTTCATTTTTGG - Intergenic
1008561707 6:52730830-52730852 TTCTCTCCAGTCCTCATTTTTGG - Intergenic
1008805966 6:55428998-55429020 TCCTTCAAAGTTGTCATTTTGGG - Intergenic
1009259668 6:61468912-61468934 TTCCTTGAAGTCTTCATCTTGGG - Intergenic
1009693329 6:67064480-67064502 TTTTTCCATATCTTCACTTTTGG + Intergenic
1010347354 6:74827040-74827062 GTAGTCCAACTCTTCATTTTGGG + Intergenic
1010614865 6:78000480-78000502 TTCTTCTGAGTCTGTATTTTAGG - Intergenic
1011179188 6:84600627-84600649 TTCTTTCCGATCTTCATTTTAGG + Intergenic
1011215543 6:85001784-85001806 TTCTTCCAAGTTTTCCTCCTGGG - Intergenic
1011647652 6:89475522-89475544 TTCTTTGATGTCTTTATTTTTGG - Intronic
1011944387 6:92882420-92882442 TTCCTCCATCCCTTCATTTTGGG - Intergenic
1012185736 6:96214111-96214133 TTCTCCCAAAACTTTATTTTTGG + Exonic
1012760097 6:103290031-103290053 TTCTCCCAAGCCTTCAGTGTGGG - Intergenic
1013259124 6:108421332-108421354 TTCTTCAAAGCCTTCACTGTTGG + Intronic
1013905592 6:115213799-115213821 TTCTCCCAAATATCCATTTTTGG - Intergenic
1014130209 6:117822500-117822522 TTTTTCCATTTGTTCATTTTAGG - Intergenic
1017258245 6:152358869-152358891 TACGTCCAAATCTTCATTTAAGG - Intronic
1020696279 7:11417762-11417784 TCCTTTTAAGTCTTCATTTGTGG - Intronic
1020903846 7:14040475-14040497 TTCTTCCCAGCCTTTATTCTAGG + Intergenic
1020983305 7:15099153-15099175 TTGTTCCCAGTCTCCAATTTTGG - Intergenic
1021126954 7:16862020-16862042 TTCTTGTATTTCTTCATTTTGGG + Exonic
1021173495 7:17423100-17423122 TACTTCCAAATCTTTAATTTGGG - Intergenic
1021413622 7:20356235-20356257 TTATTCCAAGTTTTGATTTGAGG - Intronic
1021732659 7:23611240-23611262 TTTTTTCAAGTCTTGATTTGTGG + Exonic
1023329944 7:39104289-39104311 TGCTTACAAATCTTCAATTTTGG + Intronic
1023478037 7:40602295-40602317 TTCTTTTAAGTTTTCATTTCTGG - Intronic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1024353163 7:48388268-48388290 TTCTTACACATATTCATTTTGGG - Intronic
1024546223 7:50522504-50522526 TTCTACTAAGTCTTGAATTTGGG - Intronic
1024803241 7:53105672-53105694 TTCTCCCAAGTTTTCCTTCTTGG - Intergenic
1024838344 7:53552029-53552051 TTCTTCTAAGGCTTATTTTTGGG + Intergenic
1024959016 7:54955980-54956002 CTCTGCCTATTCTTCATTTTGGG + Intergenic
1025533320 7:61917387-61917409 TTCTTCCTAGTTTTTATCTTGGG - Intergenic
1025535822 7:61946833-61946855 TTCTACCAAGTTTTCATCTTGGG - Intergenic
1025536612 7:61956199-61956221 TTCTTCCTAGTTTTCATATGGGG - Intergenic
1025593497 7:62894710-62894732 TTCTTTCTAGTTTTCATCTTGGG + Intergenic
1027869568 7:83689852-83689874 TTCTTCAAAATGTTTATTTTAGG - Intergenic
1028723676 7:94062306-94062328 TTTATCCAAGTCACCATTTTTGG - Intergenic
1029329050 7:99836163-99836185 TTCTTCCAAGCCTGACTTTTCGG - Intronic
1029906009 7:104094014-104094036 TTCAGCCAAGTCTCCAATTTAGG - Intergenic
1030168881 7:106581821-106581843 TTCTTTCCAGTTTTTATTTTAGG - Intergenic
1030908714 7:115219683-115219705 TTCTTTCATGTTTTCATTTTTGG - Intergenic
1031482242 7:122292230-122292252 TTCTTTCAAGTTTCCATTCTAGG + Intergenic
1031877277 7:127156069-127156091 TTCTTCATAGTCTTTATCTTAGG - Intronic
1032742363 7:134751639-134751661 CTCTTCAAAGTCTTTATTGTTGG + Intronic
1032817232 7:135488511-135488533 TTCTTCAAAGATTTCAGTTTAGG - Intronic
1032966065 7:137099469-137099491 TTCTTTCAAATTTTTATTTTAGG - Intergenic
1033275522 7:139968651-139968673 TTCTTCCAAATCGTCTTGTTTGG + Intronic
1033543796 7:142381500-142381522 TTCTTCCAAGCTATCTTTTTGGG + Intergenic
1034804789 7:154079964-154079986 TTCCTTCAAGTCTTCTTATTTGG - Intronic
1035497236 8:63000-63022 TTATCCCAAGCTTTCATTTTGGG - Intergenic
1036077157 8:5514612-5514634 CTCTTCCAAATTTGCATTTTTGG - Intergenic
1036089982 8:5655200-5655222 CTGTTGCAAGCCTTCATTTTAGG + Intergenic
1036106159 8:5842580-5842602 TTCATAAACGTCTTCATTTTTGG - Intergenic
1037306825 8:17513673-17513695 TTTTTACAAGACATCATTTTTGG + Intronic
1037456243 8:19067355-19067377 CTCATCCAAGGCTTCATTTGAGG + Intronic
1037850209 8:22321425-22321447 TTCTTTCAGGTCCTCATTATTGG + Intronic
1038050382 8:23804303-23804325 TTCTTTCATTTCTTAATTTTTGG + Intergenic
1040113118 8:43582317-43582339 TTCTTTTGAGTTTTCATTTTGGG - Intergenic
1040118760 8:43656722-43656744 TTCTTTCTAGTTTTCATTTGGGG - Intergenic
1040118899 8:43658605-43658627 TTCTTTCTAGTTTTCATCTTGGG - Intergenic
1040123806 8:43712837-43712859 TTCTTTCAAGTTTTTATTTGGGG - Intergenic
1040128313 8:43764374-43764396 TTCTTTCAAGTTTTTATTTGGGG - Intergenic
1040128360 8:43764886-43764908 TTCTTTCTAGTTTTTATTTTGGG - Intergenic
1040130312 8:43788169-43788191 TTCTTTCAAGTTTTCATCTGGGG - Intergenic
1040131066 8:43797332-43797354 TTCTTTCTAGTTTTCAATTTGGG - Intergenic
1040134926 8:43841962-43841984 TTCTTTCTAGTTTTCATTTTAGG - Intergenic
1040136747 8:43863158-43863180 TTCTTCCTAGTTTTCATCTTGGG - Intergenic
1040321958 8:46316478-46316500 TTCTTTCTAGTTTTCATCTTGGG + Intergenic
1040343628 8:46462549-46462571 TTCTTTCTAGTTTTTATTTTTGG + Intergenic
1040344387 8:46474352-46474374 TTCTTTCAAGTTTTCATTGCAGG + Intergenic
1040344595 8:46477785-46477807 TTCTTTCTAGTTTTTATTTTGGG + Intergenic
1040344866 8:46482150-46482172 TTCTTTCAAGTTTTTATTGTCGG + Intergenic
1040345881 8:46493072-46493094 TTCTTTCTAGTTTTCATTGTGGG + Intergenic
1040346105 8:46497359-46497381 TTCTTTCTAGTTTTCATTTTGGG + Intergenic
1040458494 8:47623519-47623541 TTCCTCCATCCCTTCATTTTGGG - Intronic
1040904688 8:52454914-52454936 TTCATCAAAGTTTTCATATTTGG - Intronic
1041386273 8:57307445-57307467 TTCTAACAAGTCTGCATGTTTGG + Intergenic
1042341390 8:67683815-67683837 TTCTTTCTATTCTTCATATTGGG + Intronic
1042677131 8:71333752-71333774 TTTTTCCAGGTCTTCAAATTTGG - Intronic
1042775978 8:72431743-72431765 TTCTTCCAAGTGTACATGTGTGG + Intergenic
1043661525 8:82748396-82748418 TTCTTTGAAGACTTCAATTTGGG + Intergenic
1043808177 8:84700579-84700601 TTGGTCCAAGTTTTCATTTGTGG - Intronic
1044494483 8:92860549-92860571 TCCTTACTATTCTTCATTTTAGG + Intergenic
1044571882 8:93728440-93728462 TTTTTTAAAGCCTTCATTTTTGG - Exonic
1045127849 8:99113462-99113484 TTCTTCCAAGTCCTAATCCTAGG + Intronic
1045539219 8:103066361-103066383 TTCTTCAAAGTTTTCTTATTGGG - Exonic
1045588344 8:103564284-103564306 TTCTTCAAAGTAGTCACTTTGGG + Intronic
1045795957 8:106044623-106044645 TACTTCCAAGTTTTCTCTTTTGG + Intergenic
1046384257 8:113488148-113488170 TTGTTCCTACTCTTCATTTTCGG + Intergenic
1046458416 8:114501262-114501284 TTCTTCCAGGTTTTCAGTTTTGG + Intergenic
1047161066 8:122380197-122380219 TTCTCCTAAGTTTTCACTTTTGG - Intergenic
1048079191 8:131106470-131106492 CTTTTCTAAGTCCTCATTTTGGG + Intergenic
1048500044 8:134967256-134967278 TTCTTATAATTCTTGATTTTTGG + Intergenic
1048563521 8:135568665-135568687 TTCTTCCAAATCTTTATATTTGG - Intronic
1048756445 8:137743871-137743893 TTCTCCAAAGTCTTCATTTGAGG + Intergenic
1048826388 8:138431682-138431704 TTCCTCAAAATCTTCATTTATGG - Intronic
1049940132 9:537585-537607 TTATTCCAGGGCTTCATCTTAGG - Intronic
1050069602 9:1796572-1796594 CTCTCCCAAGTCTTATTTTTTGG - Intergenic
1050357725 9:4798834-4798856 TGCTTCCAAGTGATGATTTTTGG + Intronic
1050646384 9:7724020-7724042 TTATTACAAGTATTTATTTTGGG + Intergenic
1050772238 9:9216639-9216661 TTCTTATAAGTCTTCAGCTTGGG + Intronic
1050809718 9:9728923-9728945 TTATCCCAAGTCTTCTATTTTGG + Intronic
1051160882 9:14205838-14205860 TTTTTTTAAGTCTCCATTTTAGG + Intronic
1051494736 9:17707302-17707324 TTCTTCTAAATCTTCCTCTTGGG + Intronic
1051607866 9:18934113-18934135 TCCTTCCAAATCTTTGTTTTTGG + Intronic
1052215425 9:25961245-25961267 CTCTCCCCAGTCCTCATTTTTGG + Intergenic
1052649441 9:31282196-31282218 TTTTTCCAATTCTTGAATTTGGG - Intergenic
1053738651 9:41118168-41118190 TTGTTCCTAATCTCCATTTTGGG + Intergenic
1054363078 9:64197805-64197827 TTCCTTGAAGTCTTCATCTTGGG - Intergenic
1054689692 9:68313147-68313169 TTGTTCCTAATCTCCATTTTGGG - Intergenic
1055110883 9:72558194-72558216 TTTTCCCATGTCTTCATTTATGG - Intronic
1055480830 9:76707798-76707820 TTCCCCGAAGTCTTGATTTTGGG - Exonic
1056302399 9:85256008-85256030 TTCCTCCATCTCTTTATTTTGGG + Intergenic
1057639546 9:96804156-96804178 TTTTTCCATCCCTTCATTTTCGG - Intergenic
1057744100 9:97737875-97737897 TTCTACAAAGACTACATTTTGGG - Intergenic
1058650345 9:107170089-107170111 TCCTTCCAAGTGTTAGTTTTGGG + Intergenic
1059696762 9:116737088-116737110 TTCTTCCCAGTCTTCCATATTGG - Intronic
1059750367 9:117241891-117241913 TTCTACTCAGTCTGCATTTTTGG - Intronic
1061230030 9:129310264-129310286 TTCTTCCAGGTCTTCTCTTGTGG + Intergenic
1061440267 9:130598002-130598024 TTTTTCCATGTCTACCTTTTGGG - Intronic
1061562873 9:131417646-131417668 TTCTTCGCTGTTTTCATTTTCGG + Intronic
1186038640 X:5452208-5452230 TTCTTCCACATCTGAATTTTGGG - Intergenic
1186059792 X:5691655-5691677 TTCTACCAAGTCCACATTCTAGG + Intergenic
1187601176 X:20832329-20832351 TTCTTTCAGGTCTTTTTTTTTGG - Intergenic
1187662611 X:21566868-21566890 CACTTCTAAGTCTTCATTATAGG - Intronic
1187977053 X:24713270-24713292 TTCTTTCAATTATTCATTGTTGG + Intronic
1188421080 X:29991615-29991637 TACTTCCAAGTGTTCACTTTAGG + Intergenic
1189401098 X:40669440-40669462 AACTTCCAAGTCTTCATCTGTGG + Intronic
1189571213 X:42299930-42299952 TTCTTTCCAGTTTTTATTTTAGG + Intergenic
1190723066 X:53167163-53167185 TTCTCTCTAGTCCTCATTTTTGG - Intergenic
1190817627 X:53942334-53942356 TTCCTCATAGACTTCATTTTAGG - Intronic
1191054951 X:56232172-56232194 TGCTTGCAAGCCTTAATTTTGGG + Intergenic
1191193393 X:57691449-57691471 TTCTTCCAACTTTACTTTTTTGG + Intergenic
1191577460 X:62722247-62722269 TTCTTCCCAGTTTTTATTTGGGG + Intergenic
1192151764 X:68717207-68717229 CTCTTCTGAGTCTTCATTCTGGG - Exonic
1192777329 X:74258872-74258894 TTCTCTCCAGTCCTCATTTTTGG - Intergenic
1193791321 X:85818707-85818729 CTCTCTCAAGTCCTCATTTTTGG - Intergenic
1193896028 X:87115876-87115898 TTATTGTAAGTCTTTATTTTAGG - Intergenic
1194326504 X:92525020-92525042 TTCTTCCAAGTTTCCATTTAAGG - Intronic
1194809960 X:98377090-98377112 TTCTCTCCAGTCCTCATTTTTGG + Intergenic
1196369353 X:114958503-114958525 TGGTTCAAAGTCATCATTTTAGG - Intergenic
1196798371 X:119520670-119520692 TGCTTCCAAGTCTTGGCTTTTGG - Intergenic
1198089071 X:133309866-133309888 TTCTCCCATGGCTTCATTCTGGG + Intronic
1198816238 X:140594027-140594049 TACTTCCAAGTCTTCATTGGCGG + Intergenic
1200376451 X:155785715-155785737 TTCTTTCATTTCTCCATTTTTGG + Intergenic
1200635223 Y:5644223-5644245 TTCTTCCAAGTTTCCATTTAAGG - Intronic
1200757844 Y:7007855-7007877 TTTTTACAAGTCTACATTTATGG + Intronic
1201286124 Y:12380170-12380192 GTCTTCAAAGTCTGCATTTTCGG + Intergenic
1201684996 Y:16691276-16691298 TTTTTCCATGCATTCATTTTTGG - Intergenic
1201731514 Y:17209753-17209775 TTATTCCAAATCTACATATTTGG - Intergenic
1201777276 Y:17679900-17679922 TTCTTCCCAGTATTTATTCTGGG + Intergenic
1201779575 Y:17704441-17704463 TTCTTTCTAGTTTTCATCTTGGG + Intergenic
1201780088 Y:17711072-17711094 TACTTCCAACTATTCAATTTTGG - Intergenic
1201821467 Y:18194920-18194942 TACTTCCAACTATTCAATTTTGG + Intergenic
1201821981 Y:18201551-18201573 TTCTTTCTAGTTTTCATCTTGGG - Intergenic
1201824281 Y:18226092-18226114 TTCTTCCCAGTATTTATTCTGGG - Intergenic