ID: 1106446374

View in Genome Browser
Species Human (GRCh38)
Location 13:29835923-29835945
Sequence TAGATCATGCAGGACCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 7, 3: 35, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106446374 Original CRISPR TAGATCATGCAGGACCCTGA AGG Intronic
901120999 1:6893634-6893656 AAGATCATGCAGAAGCCCGATGG - Intronic
901257569 1:7843779-7843801 TGGAGCCTGCAGGACCCTGTGGG - Exonic
901507279 1:9692925-9692947 TAGATCATGTAGACCCCTGTTGG + Intronic
901789497 1:11646902-11646924 TTCATCAAGCTGGACCCTGAGGG + Intergenic
904053485 1:27655362-27655384 TAGATCACGCAGGGCCTTGTAGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905843310 1:41204438-41204460 CAGATCATGCAGGACTATGTGGG - Intronic
905926567 1:41754186-41754208 AAGGTCCTGCACGACCCTGATGG - Intronic
906096556 1:43228147-43228169 TGGATCACGCAGGACCTTGTGGG - Intronic
906100292 1:43255975-43255997 CAGATTGTGCAGGACCGTGAAGG + Intronic
906254079 1:44334072-44334094 AAGACTATGCAGGAGCCTGACGG + Intronic
906680308 1:47721769-47721791 TAGATCACACAGGTCCCTGGAGG - Intergenic
906957254 1:50384925-50384947 GAGAACATGGAAGACCCTGAAGG - Intergenic
907459713 1:54598199-54598221 AAGATCCTGGAGGAGCCTGATGG + Intronic
907924764 1:58944832-58944854 TAGATCATCCAGGACCTTATGGG + Intergenic
911356960 1:96834438-96834460 TGGATCATGCGGGAAACTGAGGG - Intergenic
911596301 1:99802124-99802146 AAGATCATGTAGGAACCTGAAGG - Intergenic
912188966 1:107315458-107315480 GAGATCATGCATGAGCCTGAAGG - Intronic
912734503 1:112138271-112138293 TAGATTATAAAGGACCTTGAAGG - Intergenic
913077324 1:115352158-115352180 CACACCATGCAGGACCCTGGAGG - Intergenic
913286902 1:117234880-117234902 TAGATCATGTAGGGCCTTGTGGG + Intergenic
913327812 1:117642753-117642775 TAGTTCATGCATGAACCTCATGG + Intergenic
916784163 1:168071786-168071808 TATGTCATGTAGGACCTTGAAGG - Intronic
917686898 1:177425356-177425378 TAGGTCATCCAAGACCATGATGG - Intergenic
917948722 1:180005687-180005709 TAGATCATGCAGGGCCATCTAGG - Intronic
918514277 1:185345235-185345257 TAGCTCATGTAGGACCATGTAGG - Intergenic
921124477 1:212164883-212164905 TAGATTAAACAGGACCTTGAAGG - Intergenic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
1069001545 10:63272230-63272252 TAGAACATGCATGATCCAGAAGG + Intronic
1070741763 10:78907895-78907917 TAGGTCAGGCAGGACCCCAAGGG - Intergenic
1070849216 10:79550058-79550080 CAGACCATGTGGGACCCTGATGG + Intergenic
1073846317 10:107559386-107559408 AAGAACATGCATGAACCTGAAGG + Intergenic
1075714503 10:124548286-124548308 CAGCTCATGCGGGAGCCTGAAGG - Intronic
1076108552 10:127844236-127844258 TAGATGATGCAGAATGCTGATGG + Intergenic
1076317903 10:129555860-129555882 AAGAACATTCAGGACTCTGACGG - Intronic
1077900825 11:6486984-6487006 TGGATCATGCAGGGCCTTGTAGG - Intronic
1080504654 11:32900590-32900612 TAGATCATGCAGGGCTTTGTAGG - Intronic
1080760537 11:35244820-35244842 TAGATAATGCAGGACCCTATGGG + Intergenic
1081470811 11:43368800-43368822 TAGATCTTACAGGACCTTGTAGG - Intronic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1083786765 11:64953873-64953895 AGGATCTTGCAGGACCCTCAAGG - Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1085375248 11:76054489-76054511 TACATCATGCAGGGTCCTGGAGG - Intronic
1086013976 11:82142009-82142031 TAAATCTTGTAGGACCCTCAGGG + Intergenic
1086513715 11:87588567-87588589 TAGACCATGCAGGGCCTTCATGG + Intergenic
1088270469 11:108028924-108028946 TGGATCTTGTAGGACCCTGAAGG - Intronic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1089206713 11:116770312-116770334 TGGACCATGCAGGATCCTGTAGG - Intronic
1089351789 11:117825436-117825458 TGGAGCATGCAGGATCCTTAAGG + Intronic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1091461808 12:648731-648753 CAGATCATGATGGACCCTGAAGG - Intronic
1091578409 12:1761959-1761981 GAGATCACGCAGGATCCCGAAGG - Intronic
1091719446 12:2801871-2801893 TGGACCATCCAAGACCCTGAAGG - Intronic
1092800130 12:12156470-12156492 TAGGTCATGTAGGACCCAGTAGG + Intronic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1095667313 12:44817693-44817715 TGGATGAGGCAGGACCCTGCAGG + Intronic
1097973400 12:65659406-65659428 TGGATCATGCAGGACCTCGCAGG - Intergenic
1099514352 12:83578343-83578365 TATATGATGCAGGCCGCTGAAGG - Intergenic
1099906225 12:88774173-88774195 TAGATCTTGCAGAACCCAAAGGG + Intergenic
1100016070 12:90012263-90012285 TAAATCATCCAGGACCTTGTTGG - Intergenic
1100762140 12:97819796-97819818 TTGATGATGCAAGACCCTGAAGG - Intergenic
1101001341 12:100361235-100361257 TAGATCACAGAGGACCTTGAAGG - Intronic
1106310082 13:28546444-28546466 TAGATCATGCAGAACCTTGTAGG + Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1108030582 13:46225140-46225162 CACAGCATGCAGGACCCAGAGGG - Intronic
1108161549 13:47645463-47645485 CAGATCATGCAGGGCCCTGTAGG - Intergenic
1109339931 13:61043120-61043142 GAGATCATTCAGGACATTGAAGG + Intergenic
1109383520 13:61597437-61597459 GGGATCATTCAGGACCCTGTAGG + Intergenic
1110619904 13:77584037-77584059 TATATCCTGCAGGACCCTTGAGG + Intronic
1111698974 13:91661843-91661865 CAGATCATTCAGGGCCCTGTGGG + Intronic
1114596554 14:23917251-23917273 TGGGCCATGCAGGACCCAGAAGG + Intergenic
1115732666 14:36287994-36288016 CAGATCATGTAGGGCCCTGTAGG + Intergenic
1116452220 14:45079806-45079828 TATATCAATCAGGACCCAGAAGG + Intergenic
1116814079 14:49567396-49567418 TTGATGGTGCAGGACCTTGAAGG - Intergenic
1119861744 14:77940920-77940942 AAGATCACACAGAACCCTGAGGG - Intergenic
1120085410 14:80266872-80266894 TACATCATGCTGGTCCCTTATGG - Intronic
1120316620 14:82902496-82902518 CAGATCATGCAGTACACTGTAGG - Intergenic
1120991312 14:90379928-90379950 CAGATTATGGAGGGCCCTGAAGG + Intergenic
1121691931 14:95884255-95884277 CAGATCGTGCAGGGCCCTGAGGG - Intergenic
1122000477 14:98647040-98647062 TAGTTGATGCAAGACCCTGTAGG + Intergenic
1126271015 15:46816715-46816737 TAGAGCCTGGTGGACCCTGAAGG - Intergenic
1126564941 15:50085103-50085125 AAGATTAGGCAGGGCCCTGAAGG - Intronic
1128425621 15:67539557-67539579 TACAACATGATGGACCCTGAAGG + Intergenic
1130518458 15:84644294-84644316 TAGATCGTGCAGGGACGTGAAGG - Intronic
1134306582 16:13038382-13038404 TAGATTGTGCAGGACCTTGTGGG - Intronic
1134801144 16:17085892-17085914 CAGATCATGCATTACCCTGCAGG - Intergenic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138873189 16:60917717-60917739 TAGAACAGGCGGGACCCTGTAGG - Intergenic
1139739250 16:69021172-69021194 TAGATCATGAAGGGCCTTGCAGG - Intronic
1143117288 17:4588231-4588253 CAGATCAGGCAGCACCCAGAAGG + Intronic
1143170894 17:4929673-4929695 GAGACCTTGCAGGACCCTGCAGG + Intergenic
1144444606 17:15315301-15315323 CAGATCATGCAGGGCCCTAATGG + Intronic
1145842042 17:28003400-28003422 CAGATCATGTAGGGCCCTAAAGG + Intergenic
1146791803 17:35755074-35755096 TAGATCATGCAGGGCCTTGTAGG + Intronic
1147556371 17:41481737-41481759 TAGATACTGCAGAGCCCTGATGG + Intergenic
1148724519 17:49779176-49779198 CAGACCAGGCAGGACACTGAAGG + Intronic
1149357545 17:55857715-55857737 TAGATCATTCTGAACCCAGAAGG - Intergenic
1150162939 17:62914699-62914721 CTGATCATGTAGAACCCTGAAGG - Intergenic
1151430399 17:74058509-74058531 AACTTCATCCAGGACCCTGAAGG + Intergenic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1155243236 18:23883157-23883179 CAGATCCTGCAGAACCCTGCAGG + Intronic
1156392042 18:36659865-36659887 TAGAAGATCCAGGATCCTGAAGG + Intronic
1158157151 18:54438860-54438882 TAGATCACATAGGACCCTGTAGG - Intergenic
1161605700 19:5213726-5213748 TAGGTCAAGCAGGTGCCTGACGG + Intronic
1161644489 19:5444680-5444702 TAGGTCATGCAGGGCCTTGTGGG - Intergenic
1162544698 19:11321693-11321715 CAGATCATGCAGGGCCCCGGGGG + Intronic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1163000130 19:14362063-14362085 CAGATCCTGCAGGGCCCTGTGGG + Intergenic
1165649172 19:37470557-37470579 CAGATTATGCAGGGCCCTGCAGG - Intronic
1166049594 19:40250107-40250129 TGGATCATACAGGACTCTGCAGG + Intronic
1166588715 19:43975378-43975400 TAGATCATCCAGGACATGGATGG + Intronic
1166728217 19:45041749-45041771 CAGGCCATGCAGGACCCTAAAGG - Intronic
1167160770 19:47765947-47765969 TTGATCACGCAGGACCATGGTGG - Intergenic
1167204765 19:48093583-48093605 CAGATCATATGGGACCCTGAAGG - Intronic
1167297230 19:48658469-48658491 TAGATCATGCAGGGCTTTGTGGG + Intergenic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
925440239 2:3879381-3879403 TAAATCATCCAGGACTCTGCAGG + Intergenic
926311684 2:11680075-11680097 TAGATCAGGCAGGCCCCCGATGG + Intronic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930282340 2:49385436-49385458 TAGATCATATAGGATCTTGAGGG - Intergenic
930886598 2:56333458-56333480 CAGATCACACAGGGCCCTGATGG + Intronic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG + Intronic
932235682 2:70119379-70119401 TGGGTCATGTAGGACCCTGTGGG + Intergenic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
932803473 2:74763511-74763533 GGGATCATGCAGGCCACTGAAGG - Intergenic
933453351 2:82487867-82487889 GAGATCATGAAGGACAGTGAGGG + Intergenic
933583810 2:84158470-84158492 CAGATCATGTAGGTCACTGAAGG + Intergenic
939706520 2:145460276-145460298 TAAATTATGCAGGACCTTGTGGG + Intergenic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
941083157 2:161085967-161085989 GAGATCATATAGGGCCCTGAAGG + Intergenic
941568852 2:167143459-167143481 TAGATCCTGCAAAACCATGAAGG + Intronic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
943043469 2:182830213-182830235 TAGATTATGGAGGACTCTGGTGG + Intergenic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944907224 2:204274636-204274658 TAGGTCCAGCAGGAGCCTGAAGG + Intergenic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
1169874031 20:10276949-10276971 AAGATTCTGCAGGAACCTGAAGG - Intronic
1171101892 20:22391620-22391642 TAGAAGAGACAGGACCCTGATGG + Intergenic
1172012695 20:31855475-31855497 TAGATCATGAATGTCCTTGAAGG + Intronic
1172646781 20:36475131-36475153 AAGGTCAGGCAGGACCCTGGGGG + Intronic
1173749401 20:45465037-45465059 AAGATCATGAAGGACCCTGAAGG - Intergenic
1175993217 20:62799825-62799847 TGGACCATGTGGGACCCTGATGG + Exonic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1182190381 22:28453908-28453930 TAGATCATGTATGACCTTGTAGG - Intronic
1182311329 22:29410121-29410143 TAGATCATGCTGGGCCCTGTTGG - Intronic
1182516847 22:30863885-30863907 CAGACCAGGCAGGGCCCTGAGGG - Intronic
1183026611 22:35070203-35070225 TAGATCATGAAGGTCCCTGCAGG - Intronic
1183237503 22:36630568-36630590 GAGGTCATGAAGGACCCTGTTGG + Intronic
1184809934 22:46824505-46824527 TGCATCCTGCAGGCCCCTGAGGG + Intronic
949390605 3:3558291-3558313 TAGATCTTGTAGGACCCTTATGG - Intergenic
949478729 3:4472998-4473020 TAGATCATGGAGGACCTTCTTGG - Intergenic
950076552 3:10191458-10191480 TAGACCATGCAGGGCCTTGTAGG - Intronic
951738572 3:25895462-25895484 TGGATCATGTAGGACCTTGTAGG - Intergenic
952715472 3:36475863-36475885 TAGGTCAGGCAGGAGTCTGATGG + Intronic
953512699 3:43558886-43558908 CAGATCACGCAGAACCCTGCAGG + Intronic
953839130 3:46374691-46374713 TAGATCATGAAGAACCTTGACGG + Exonic
954111771 3:48437568-48437590 TAGGTGAAGCAGGGCCCTGAGGG + Intronic
954615054 3:51965246-51965268 TGGATCATGAAGGTCCTTGATGG - Intronic
954702534 3:52457846-52457868 TACATCATCCAGGTCACTGATGG + Exonic
957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG + Intronic
957883811 3:86256591-86256613 TAGATCATGTAGGGCCCTGTAGG + Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
960148152 3:114225401-114225423 TGGATCCTGCTGGCCCCTGAGGG + Intergenic
962072713 3:132048360-132048382 TGGATCATGCAGGACCTTGCAGG - Intronic
964373950 3:156031269-156031291 CAGATCATGCAGGGCCCTGTTGG + Intergenic
964763722 3:160158380-160158402 TGGATCATGCAGGGCCTTGTAGG - Intergenic
964814171 3:160698966-160698988 TAGCTCATTCAGGACACTGAAGG - Intergenic
965247887 3:166298937-166298959 GAGATCGTGCAGGACCTTTAAGG - Intergenic
965397967 3:168183408-168183430 TATAGCATGCAGGTCCATGATGG - Intergenic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
967675125 3:192289082-192289104 ATAATCATGCAGGAACCTGAAGG + Intronic
968774934 4:2535216-2535238 AGGATCATCCAAGACCCTGATGG + Intronic
969525256 4:7701046-7701068 TGGATCCTGCAAGTCCCTGATGG + Intronic
971379151 4:26081040-26081062 GAGATCATCAAGGGCCCTGAGGG + Intergenic
975137921 4:70892580-70892602 TAGATGATGCAAGTCCCTGGAGG + Intergenic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
977316052 4:95449123-95449145 TAGACCTGGCAGGACCCAGAGGG + Intronic
977567982 4:98600775-98600797 TGGATCATGAAGGACCTTAATGG + Intronic
980051231 4:128042340-128042362 TAGATTATGCAGGGTCCTGTAGG + Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
983720336 4:170843497-170843519 GAGATCAAGCAGAACCCTGTTGG + Intergenic
987065182 5:14283005-14283027 TAGCACCTGCAGGACCCTGGGGG - Intronic
987246943 5:16058749-16058771 TAGATCACGTAGGACCTTGTGGG + Intergenic
992751719 5:79868568-79868590 TAAATCATACAGAGCCCTGAAGG + Intergenic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997605950 5:135176150-135176172 GAGATCTGGCAGGAACCTGAGGG - Intronic
999411270 5:151351936-151351958 TGGATCATGCAGGACCTTGTGGG - Intergenic
1000978985 5:167796312-167796334 TAGATCATGCAGCCCCTTGTAGG - Intronic
1001716124 5:173817870-173817892 TAGATCAGGGAGGAGCCTGGAGG + Intergenic
1007955468 6:45914191-45914213 TGGATCTTGCAGGCCCCTGTGGG + Intronic
1008775764 6:55035719-55035741 CAGATCATGTAGGACCCCGTAGG - Intergenic
1009885125 6:69616483-69616505 TGGTTCATGCAGAAGCCTGATGG - Intergenic
1010259243 6:73796266-73796288 CAGATCACCCAGGACCCTGTAGG - Intronic
1010308101 6:74348786-74348808 CAGATCATTCAGGAACCTGTAGG + Intergenic
1011772870 6:90694392-90694414 AAGATCATGCAGGACTCTGAAGG + Intergenic
1012649393 6:101734676-101734698 CAGATCCTACAGGGCCCTGAAGG + Intronic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1018230059 6:161666720-161666742 TATATCATTCAGGACAGTGAGGG - Intronic
1018287898 6:162260318-162260340 TAGATCATACAGTACTCTGAAGG + Intronic
1018735590 6:166685191-166685213 AAGCTCAGGCAGGACCCTGATGG + Intronic
1018735603 6:166685257-166685279 AAGCTCAGGCAGGACCCTGATGG + Intronic
1018735617 6:166685323-166685345 AAGCTCAGGCAGGACCCTGATGG + Intronic
1019791561 7:3017293-3017315 TAGATCAAACAGGACGCTGGAGG + Intronic
1021330427 7:19331698-19331720 TACATCATGGATGACCCTCAAGG - Intergenic
1022477005 7:30717577-30717599 AAGGTCATGCAGGGCCCTGTGGG + Intronic
1023564529 7:41510475-41510497 TAGCTGATGCAGGGCCTTGAAGG - Intergenic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1031584522 7:123518464-123518486 TAGATCATTTAGGACCTTGAAGG - Intronic
1032140644 7:129326854-129326876 TGGATCATGTAGGACCCTGAGGG + Intronic
1033133732 7:138767767-138767789 CAGATCATGGAGGACCCTGGGGG - Intronic
1034550661 7:151818640-151818662 CAGATCTTGCAGGACAGTGAGGG - Intronic
1038821129 8:30952738-30952760 CAGAGCATGCAGGGCCATGAAGG + Intergenic
1039153970 8:34534736-34534758 TACAGCATGGAGGACACTGATGG - Intergenic
1039833590 8:41237229-41237251 TAGATCCCCCAGGCCCCTGAGGG - Intergenic
1040416310 8:47198824-47198846 GATGGCATGCAGGACCCTGAAGG + Intergenic
1041876763 8:62697197-62697219 TAGATCATGTAGGGCTCTGTTGG - Intronic
1042685441 8:71433774-71433796 CAGATCATTCAGCATCCTGAAGG + Intronic
1042737306 8:72004047-72004069 CAGATCAGGCAGAATCCTGACGG + Intronic
1043207906 8:77470867-77470889 AAGATCAGGTAGGACCTTGAAGG + Intergenic
1044222514 8:89686044-89686066 TAGATCATCCAGGGCCCTTGGGG + Intergenic
1044426564 8:92058095-92058117 TAGATCATGCAGGAGCCCAGAGG - Intronic
1045977382 8:108145074-108145096 CAGATCATGCAGGACCCTCTTGG + Intergenic
1046913407 8:119653642-119653664 TAGTTTATGCAGGACCCTACAGG + Intronic
1046930352 8:119835901-119835923 TAGATCACGTAGAACCTTGAAGG + Intronic
1047971867 8:130091502-130091524 CCGATCATGCAGGGCCCTGTGGG + Intronic
1047972775 8:130099637-130099659 TACAACATGTATGACCCTGAAGG - Intronic
1050091949 9:2024337-2024359 AAGATCCTGCAGGACACGGAGGG - Intronic
1056953641 9:91065572-91065594 TAGACCCTGCAGGACCATGGGGG - Intergenic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1062209807 9:135357346-135357368 AAGCCCATGCAGGACCCTGTGGG - Intergenic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1190336825 X:49267645-49267667 TAGACCACGCAGGACCTTGTAGG + Intergenic
1193624707 X:83803842-83803864 TAGATCATGTAGGGCCTTGTAGG + Intergenic
1194895012 X:99429963-99429985 TAGATCATGCATGAGGTTGAAGG - Intergenic
1195239153 X:102933874-102933896 TAGAGCATTCAGGGCCCTGGAGG - Intergenic
1195994531 X:110718453-110718475 TAGACCATGCAGGATTCTGAAGG - Intronic
1196017824 X:110958228-110958250 GAGACCATGCAGAACCTTGAAGG + Intronic
1196963225 X:121026531-121026553 CAAATCATGGAGGACGCTGAAGG - Intergenic
1197752617 X:129975902-129975924 TAGATCAGGGAGGGCCCTAAAGG + Intergenic
1197793305 X:130277017-130277039 TAGACCAAGCAGGATCTTGAAGG + Intergenic
1198131893 X:133704090-133704112 TAGATCATGCAGAGCCCAGTAGG + Intronic
1198413345 X:136394039-136394061 TAGATCTTGCAAAACCCTGTGGG - Intronic
1198802002 X:140457672-140457694 CAGGTCATGCAGGGCCCTGCAGG - Intergenic
1201503152 Y:14667949-14667971 CAGATCATTCAGGTCCCTGTTGG + Intronic