ID: 1106448829

View in Genome Browser
Species Human (GRCh38)
Location 13:29861563-29861585
Sequence CACTCTGAAGAGAAGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106448829_1106448833 14 Left 1106448829 13:29861563-29861585 CCAAGCTTCTTCTCTTCAGAGTG No data
Right 1106448833 13:29861600-29861622 CCTCTCCCATCTTGAAAAACAGG No data
1106448829_1106448834 15 Left 1106448829 13:29861563-29861585 CCAAGCTTCTTCTCTTCAGAGTG No data
Right 1106448834 13:29861601-29861623 CTCTCCCATCTTGAAAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106448829 Original CRISPR CACTCTGAAGAGAAGAAGCT TGG (reversed) Intergenic
No off target data available for this crispr