ID: 1106449592

View in Genome Browser
Species Human (GRCh38)
Location 13:29868076-29868098
Sequence GCGTGGTGGCATGCACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106449586_1106449592 11 Left 1106449586 13:29868042-29868064 CCCTGTCTCTACAAAAAACACAA 0: 173
1: 6438
2: 82598
3: 187196
4: 235799
Right 1106449592 13:29868076-29868098 GCGTGGTGGCATGCACCTGCAGG No data
1106449587_1106449592 10 Left 1106449587 13:29868043-29868065 CCTGTCTCTACAAAAAACACAAA 0: 254
1: 12237
2: 194749
3: 233029
4: 165180
Right 1106449592 13:29868076-29868098 GCGTGGTGGCATGCACCTGCAGG No data
1106449585_1106449592 30 Left 1106449585 13:29868023-29868045 CCTCGGATACGTGGCGAAACCCT No data
Right 1106449592 13:29868076-29868098 GCGTGGTGGCATGCACCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106449592 Original CRISPR GCGTGGTGGCATGCACCTGC AGG Intergenic
No off target data available for this crispr