ID: 1106452324

View in Genome Browser
Species Human (GRCh38)
Location 13:29894377-29894399
Sequence CCTTACATGCAGAAAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106452324_1106452331 -7 Left 1106452324 13:29894377-29894399 CCAGCCACTTTCTGCATGTAAGG No data
Right 1106452331 13:29894393-29894415 TGTAAGGAGGCAGCAGCAGGGGG No data
1106452324_1106452332 -1 Left 1106452324 13:29894377-29894399 CCAGCCACTTTCTGCATGTAAGG No data
Right 1106452332 13:29894399-29894421 GAGGCAGCAGCAGGGGGAGAAGG No data
1106452324_1106452328 -10 Left 1106452324 13:29894377-29894399 CCAGCCACTTTCTGCATGTAAGG No data
Right 1106452328 13:29894390-29894412 GCATGTAAGGAGGCAGCAGCAGG No data
1106452324_1106452329 -9 Left 1106452324 13:29894377-29894399 CCAGCCACTTTCTGCATGTAAGG No data
Right 1106452329 13:29894391-29894413 CATGTAAGGAGGCAGCAGCAGGG No data
1106452324_1106452330 -8 Left 1106452324 13:29894377-29894399 CCAGCCACTTTCTGCATGTAAGG No data
Right 1106452330 13:29894392-29894414 ATGTAAGGAGGCAGCAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106452324 Original CRISPR CCTTACATGCAGAAAGTGGC TGG (reversed) Intergenic
No off target data available for this crispr