ID: 1106452425

View in Genome Browser
Species Human (GRCh38)
Location 13:29895052-29895074
Sequence CTACTTGGCGGGGGGCGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106452412_1106452425 -10 Left 1106452412 13:29895039-29895061 CCTGTAGTCCCAGCTACTTGGCG No data
Right 1106452425 13:29895052-29895074 CTACTTGGCGGGGGGCGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106452425 Original CRISPR CTACTTGGCGGGGGGCGGGG GGG Intergenic
No off target data available for this crispr