ID: 1106453033

View in Genome Browser
Species Human (GRCh38)
Location 13:29901437-29901459
Sequence CTCATCAGTTCTGTGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106453033_1106453036 28 Left 1106453033 13:29901437-29901459 CCACATCACACAGAACTGATGAG No data
Right 1106453036 13:29901488-29901510 TTATGATACTTAATTTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106453033 Original CRISPR CTCATCAGTTCTGTGTGATG TGG (reversed) Intergenic
No off target data available for this crispr