ID: 1106456984

View in Genome Browser
Species Human (GRCh38)
Location 13:29936199-29936221
Sequence GTCGTTGCTCTCTACCGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106456984_1106456993 6 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106456993 13:29936228-29936250 GGTGTGGGTGTGGAGAGCAGTGG No data
1106456984_1106456990 -9 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106456990 13:29936213-29936235 AGCAACGACCAGGTGGGTGTGGG 0: 1
1: 0
2: 2
3: 4
4: 107
1106456984_1106457001 29 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106457001 13:29936251-29936273 GGCCCACCTGGGCAGGTGCGGGG No data
1106456984_1106456989 -10 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106456989 13:29936212-29936234 GAGCAACGACCAGGTGGGTGTGG 0: 1
1: 0
2: 3
3: 39
4: 182
1106456984_1106456998 22 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106456998 13:29936244-29936266 GCAGTGGGGCCCACCTGGGCAGG No data
1106456984_1106457000 28 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106457000 13:29936250-29936272 GGGCCCACCTGGGCAGGTGCGGG No data
1106456984_1106456997 18 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106456997 13:29936240-29936262 GAGAGCAGTGGGGCCCACCTGGG No data
1106456984_1106456991 -4 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106456991 13:29936218-29936240 CGACCAGGTGGGTGTGGGTGTGG 0: 1
1: 0
2: 2
3: 32
4: 388
1106456984_1106457002 30 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106457002 13:29936252-29936274 GCCCACCTGGGCAGGTGCGGGGG No data
1106456984_1106456995 8 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106456995 13:29936230-29936252 TGTGGGTGTGGAGAGCAGTGGGG No data
1106456984_1106456996 17 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106456996 13:29936239-29936261 GGAGAGCAGTGGGGCCCACCTGG No data
1106456984_1106456999 27 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106456999 13:29936249-29936271 GGGGCCCACCTGGGCAGGTGCGG No data
1106456984_1106456994 7 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106456984 Original CRISPR GTCGTTGCTCTCTACCGAGG AGG (reversed) Intergenic
903708867 1:25306946-25306968 GTCTTTGGTCTATACCTAGGTGG - Intronic
903718255 1:25385472-25385494 GTCTTTGGTCTATACCTAGGTGG + Intronic
915553332 1:156647510-156647532 GTCGTCTTTCTCTACCGAGAGGG + Exonic
1070642248 10:78178382-78178404 GTCGGTGCTCTATGCGGAGGAGG + Intergenic
1074193641 10:111160209-111160231 GTCCTTGCTCTCTGCCTAGTAGG + Intergenic
1086904500 11:92403587-92403609 GTGGTTGCTATTTACAGAGGTGG + Intronic
1106456984 13:29936199-29936221 GTCGTTGCTCTCTACCGAGGAGG - Intergenic
1117860946 14:60092119-60092141 GTCTGTGCTCGCTCCCGAGGCGG - Exonic
927510144 2:23639288-23639310 GTCGTTTCTATCTGCCGATGAGG - Intronic
927982306 2:27381649-27381671 GGAGGTGCTCTCTACTGAGGGGG - Exonic
930240357 2:48929735-48929757 GTTGTGGCTCACTACAGAGGGGG + Intergenic
1179815737 21:43904808-43904830 GTGGCTGCTTTCTACCCAGGAGG + Intronic
959948681 3:112153661-112153683 TTCTTTGATCTCTACAGAGGTGG + Intronic
981813376 4:148801146-148801168 GTCTTTCCTCTCTCCCCAGGGGG + Intergenic
1011233838 6:85193202-85193224 GTGGTTGCTCTCTACCAGTGAGG - Intergenic
1029248369 7:99218766-99218788 GTCCTTGCTCTCCACCACGGAGG - Intergenic
1031972484 7:128074645-128074667 GTCCCTGCTGTCTGCCGAGGAGG + Exonic
1036947850 8:13111727-13111749 GTAGTAGCACTCTACTGAGGAGG - Intronic
1057015034 9:91643707-91643729 GTCTTGGCTCTCTACCTAGATGG - Intronic
1197159632 X:123308960-123308982 GTCATTGCTCTCCACTGAGGAGG - Intronic
1200913232 Y:8549258-8549280 GGGGTTGCTCTCTGCCGGGGGGG + Intergenic