ID: 1106456985

View in Genome Browser
Species Human (GRCh38)
Location 13:29936202-29936224
Sequence CTGGTCGTTGCTCTCTACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106456985_1106456997 15 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106456997 13:29936240-29936262 GAGAGCAGTGGGGCCCACCTGGG No data
1106456985_1106456991 -7 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106456991 13:29936218-29936240 CGACCAGGTGGGTGTGGGTGTGG 0: 1
1: 0
2: 2
3: 32
4: 388
1106456985_1106457000 25 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106457000 13:29936250-29936272 GGGCCCACCTGGGCAGGTGCGGG No data
1106456985_1106457004 28 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106457004 13:29936253-29936275 CCCACCTGGGCAGGTGCGGGGGG No data
1106456985_1106457002 27 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106457002 13:29936252-29936274 GCCCACCTGGGCAGGTGCGGGGG No data
1106456985_1106456999 24 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106456999 13:29936249-29936271 GGGGCCCACCTGGGCAGGTGCGG No data
1106456985_1106456994 4 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG No data
1106456985_1106456995 5 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106456995 13:29936230-29936252 TGTGGGTGTGGAGAGCAGTGGGG No data
1106456985_1106457001 26 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106457001 13:29936251-29936273 GGCCCACCTGGGCAGGTGCGGGG No data
1106456985_1106456996 14 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106456996 13:29936239-29936261 GGAGAGCAGTGGGGCCCACCTGG No data
1106456985_1106456998 19 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106456998 13:29936244-29936266 GCAGTGGGGCCCACCTGGGCAGG No data
1106456985_1106456993 3 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106456993 13:29936228-29936250 GGTGTGGGTGTGGAGAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106456985 Original CRISPR CTGGTCGTTGCTCTCTACCG AGG (reversed) Intergenic
921178507 1:212613677-212613699 CTGGGCATTCCTCTCAACCGGGG - Intronic
1067222100 10:44351861-44351883 CTCCTTGTTGCTCTCTAGCGTGG - Intergenic
1070561145 10:77567323-77567345 CTGGCCGTGCCTCTCCACCGGGG - Intronic
1075709637 10:124523752-124523774 CTGGCCCTTTCTCTCCACCGGGG - Intronic
1101137841 12:101763753-101763775 CTGCTCGTTGCCCTGTACCATGG - Intronic
1102839735 12:116105981-116106003 CTGCTCTGTGCTCTCTACCATGG + Intronic
1106456985 13:29936202-29936224 CTGGTCGTTGCTCTCTACCGAGG - Intergenic
1109603101 13:64658305-64658327 CTAGTGGATGCTCTCTACAGTGG - Intergenic
1114699676 14:24664322-24664344 CTGAGAGCTGCTCTCTACCGAGG + Intergenic
1117027551 14:51636862-51636884 CTGGTCTTTTTTCTCTACAGTGG - Intronic
1119260716 14:73236770-73236792 CTAGCCATTGCTCTCTACCCTGG + Intergenic
1122418174 14:101560344-101560366 CCGGACGTTGCTCTCTACCCCGG - Intergenic
1124583361 15:30982585-30982607 CTGTTCTTTGCTCTCTTCCAAGG - Intronic
1125684767 15:41557930-41557952 CTGGTCCCTCCTCTCTACCCAGG + Intronic
1133695708 16:8260474-8260496 GTGGTCCTTGCTCTCTGCTGTGG - Intergenic
1137512467 16:49113763-49113785 CTGGTCGTTGCTCTCTCCGAGGG - Intergenic
1138304436 16:55961417-55961439 CTGCTCTTTGCTCTCTTCTGTGG - Intergenic
1147548604 17:41422300-41422322 CTGGTGGTTGGTCTCCACCATGG + Exonic
1163793090 19:19319855-19319877 CTGGAGGTTGCTTTCTACTGGGG - Intronic
1165746236 19:38231269-38231291 CGGGTCCTTGCTCTCTCCCCAGG - Intergenic
1167685390 19:50952755-50952777 CTTGTGGTTCCTCTCTACCTGGG - Exonic
926181461 2:10647926-10647948 CTGTTCTTTTCTCTCTACCATGG + Intronic
945633984 2:212323456-212323478 TTGCTCTTTGCTCTCTACCAAGG + Intronic
1173756428 20:45520833-45520855 CTGGTCATTGTTCTTTACCTGGG + Intergenic
1184614045 22:45625892-45625914 CAGGTCATTGCTCTCCACCTGGG - Intergenic
1185068976 22:48646042-48646064 CTGCTCGTTCCTCTGTACCCAGG + Intronic
954194598 3:48989240-48989262 CTGGTGGTTTCTCCCTACCCTGG - Intergenic
954392967 3:50276961-50276983 CTGGTCGTTGCTCTGGAGCTCGG - Intronic
972570785 4:40308783-40308805 GTGGTCCTTGCTTTCTCCCGAGG - Intergenic
982076609 4:151743331-151743353 CTTGTCTTTGCTCTCTCCCTAGG + Intronic
1007174517 6:39886962-39886984 CTTGTGGATGCTCTCTACCCTGG + Intronic
1010714859 6:79216777-79216799 CTGGTCTTTGCTCACTTCCATGG + Intronic
1020213149 7:6170313-6170335 CTGGGCGCTACTCTCTGCCGCGG + Intronic
1022967531 7:35487376-35487398 CTGGTCATTGCTGGCTACCATGG - Intergenic
1023315102 7:38928343-38928365 CTGGTGGGTGCTGTCTACCCAGG - Intronic
1045484751 8:102622208-102622230 CCGGGAGTTGCTCTCTACCTGGG + Intergenic
1048229616 8:132625430-132625452 GTGGTCTTTGCTCTCTAAAGAGG + Exonic
1050325101 9:4490733-4490755 CTGGGTGTTGCTGTCCACCGTGG + Exonic
1060188939 9:121580161-121580183 CTGGTCTTTGCTCCCTGCCCAGG + Intronic