ID: 1106456994

View in Genome Browser
Species Human (GRCh38)
Location 13:29936229-29936251
Sequence GTGTGGGTGTGGAGAGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106456984_1106456994 7 Left 1106456984 13:29936199-29936221 CCTCCTCGGTAGAGAGCAACGAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG No data
1106456985_1106456994 4 Left 1106456985 13:29936202-29936224 CCTCGGTAGAGAGCAACGACCAG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106456994 Original CRISPR GTGTGGGTGTGGAGAGCAGT GGG Intergenic
No off target data available for this crispr