ID: 1106460673

View in Genome Browser
Species Human (GRCh38)
Location 13:29964897-29964919
Sequence CTGGAACCCTTGGGGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106460673_1106460678 7 Left 1106460673 13:29964897-29964919 CCTGCTTTCCCCAAGGGTTCCAG No data
Right 1106460678 13:29964927-29964949 GACACTTGTTCCATGCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106460673 Original CRISPR CTGGAACCCTTGGGGAAAGC AGG (reversed) Intergenic
No off target data available for this crispr