ID: 1106462175

View in Genome Browser
Species Human (GRCh38)
Location 13:29980819-29980841
Sequence CACTGCTGCTGCTTTACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106462175_1106462180 21 Left 1106462175 13:29980819-29980841 CCTCCTGTAAAGCAGCAGCAGTG No data
Right 1106462180 13:29980863-29980885 TTGTTTTTATGAGCAGACACAGG No data
1106462175_1106462178 -3 Left 1106462175 13:29980819-29980841 CCTCCTGTAAAGCAGCAGCAGTG No data
Right 1106462178 13:29980839-29980861 GTGCCAACGGTCTTGATAATTGG No data
1106462175_1106462181 27 Left 1106462175 13:29980819-29980841 CCTCCTGTAAAGCAGCAGCAGTG No data
Right 1106462181 13:29980869-29980891 TTATGAGCAGACACAGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106462175 Original CRISPR CACTGCTGCTGCTTTACAGG AGG (reversed) Intergenic
No off target data available for this crispr