ID: 1106467815

View in Genome Browser
Species Human (GRCh38)
Location 13:30028452-30028474
Sequence CACCTTGGCCTTCCACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106467815_1106467820 6 Left 1106467815 13:30028452-30028474 CCAGTTTGTGGAAGGCCAAGGTG No data
Right 1106467820 13:30028481-30028503 CAAGACAGTGTTGTGTGGCTTGG No data
1106467815_1106467821 7 Left 1106467815 13:30028452-30028474 CCAGTTTGTGGAAGGCCAAGGTG No data
Right 1106467821 13:30028482-30028504 AAGACAGTGTTGTGTGGCTTGGG No data
1106467815_1106467822 14 Left 1106467815 13:30028452-30028474 CCAGTTTGTGGAAGGCCAAGGTG No data
Right 1106467822 13:30028489-30028511 TGTTGTGTGGCTTGGGAGCCTGG No data
1106467815_1106467823 19 Left 1106467815 13:30028452-30028474 CCAGTTTGTGGAAGGCCAAGGTG No data
Right 1106467823 13:30028494-30028516 TGTGGCTTGGGAGCCTGGACTGG No data
1106467815_1106467819 1 Left 1106467815 13:30028452-30028474 CCAGTTTGTGGAAGGCCAAGGTG No data
Right 1106467819 13:30028476-30028498 CCATTCAAGACAGTGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106467815 Original CRISPR CACCTTGGCCTTCCACAAAC TGG (reversed) Intergenic
No off target data available for this crispr