ID: 1106468397

View in Genome Browser
Species Human (GRCh38)
Location 13:30033339-30033361
Sequence GGCTGAACCCAACTGGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106468397_1106468409 14 Left 1106468397 13:30033339-30033361 CCCCCTACCAGTTGGGTTCAGCC No data
Right 1106468409 13:30033376-30033398 ATGAGGGGAGAGAGAGGTCAAGG No data
1106468397_1106468406 -2 Left 1106468397 13:30033339-30033361 CCCCCTACCAGTTGGGTTCAGCC No data
Right 1106468406 13:30033360-30033382 CCACAGGAGGCTGAAGATGAGGG No data
1106468397_1106468407 -1 Left 1106468397 13:30033339-30033361 CCCCCTACCAGTTGGGTTCAGCC No data
Right 1106468407 13:30033361-30033383 CACAGGAGGCTGAAGATGAGGGG No data
1106468397_1106468404 -3 Left 1106468397 13:30033339-30033361 CCCCCTACCAGTTGGGTTCAGCC No data
Right 1106468404 13:30033359-30033381 GCCACAGGAGGCTGAAGATGAGG No data
1106468397_1106468408 8 Left 1106468397 13:30033339-30033361 CCCCCTACCAGTTGGGTTCAGCC No data
Right 1106468408 13:30033370-30033392 CTGAAGATGAGGGGAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106468397 Original CRISPR GGCTGAACCCAACTGGTAGG GGG (reversed) Intergenic
No off target data available for this crispr