ID: 1106469900

View in Genome Browser
Species Human (GRCh38)
Location 13:30045036-30045058
Sequence TCATCCCAGCAGAATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106469900_1106469906 7 Left 1106469900 13:30045036-30045058 CCCTCCACATTCTGCTGGGATGA No data
Right 1106469906 13:30045066-30045088 TTCCTACTCTATTTTCACATAGG No data
1106469900_1106469908 27 Left 1106469900 13:30045036-30045058 CCCTCCACATTCTGCTGGGATGA No data
Right 1106469908 13:30045086-30045108 AGGCATGTTTGTTCTTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106469900 Original CRISPR TCATCCCAGCAGAATGTGGA GGG (reversed) Intergenic
No off target data available for this crispr