ID: 1106477004

View in Genome Browser
Species Human (GRCh38)
Location 13:30107663-30107685
Sequence GCTCATGGTCTGACACATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106477004_1106477008 -2 Left 1106477004 13:30107663-30107685 CCTGGATGTGTCAGACCATGAGC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1106477008 13:30107684-30107706 GCCTTGGCAGTGGAGAAACCAGG 0: 1
1: 0
2: 5
3: 42
4: 342
1106477004_1106477010 8 Left 1106477004 13:30107663-30107685 CCTGGATGTGTCAGACCATGAGC 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1106477010 13:30107694-30107716 TGGAGAAACCAGGCATCTGCAGG 0: 1
1: 0
2: 0
3: 20
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106477004 Original CRISPR GCTCATGGTCTGACACATCC AGG (reversed) Intergenic
901491886 1:9600991-9601013 ACCCATGTTCTCACACATCCTGG - Intronic
902912574 1:19611286-19611308 GCTCATGGTTTCTCACATACAGG - Intronic
902916031 1:19640161-19640183 GCTTATGTTCTGCCACACCCAGG - Intronic
907307202 1:53520023-53520045 GCTCAGGGTCTGCCTCATTCTGG - Intronic
910929655 1:92430482-92430504 GCCTCAGGTCTGACACATCCTGG - Intergenic
912502337 1:110130572-110130594 GCTCATCGCCTGACACCCCCGGG + Intergenic
912508798 1:110174612-110174634 CCTCAGGGTCTGCCAGATCCCGG + Intronic
912907016 1:113718253-113718275 ACTCCAGGTCTCACACATCCAGG + Intronic
913057949 1:115179412-115179434 GCTCTTGGCCTGACACACCAGGG + Intergenic
915202192 1:154239321-154239343 GCTCCTGGTATGATACATCCAGG + Intronic
916242719 1:162656214-162656236 GCACAGGGTCTGACACATGGAGG + Intronic
916485566 1:165255439-165255461 TCTCAGGTTCTGCCACATCCAGG + Intronic
916863087 1:168827222-168827244 GATCTTAGTCTGACATATCCAGG + Intergenic
917060973 1:171038988-171039010 GCTGATGGTCAGCTACATCCGGG - Intronic
1070028507 10:72654592-72654614 GCTCACGGTCTACCACATCGGGG + Intergenic
1070580706 10:77717038-77717060 GCTCATGATGTCACCCATCCAGG - Intergenic
1075922252 10:126223691-126223713 GCTCAGGGACAGACACATGCAGG + Intronic
1080102480 11:28475520-28475542 TTTCATGGTTTGACACATCCTGG + Intergenic
1080980386 11:37396677-37396699 TCTCATGGTCTGATCCATTCTGG + Intergenic
1081605415 11:44524526-44524548 CCTCAGGGCCTTACACATCCAGG + Intergenic
1082761510 11:57131282-57131304 GCTCATGGTCAGCCTCAGCCTGG + Intergenic
1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG + Intergenic
1084476279 11:69391466-69391488 GCTCAGGGGCTGACAGATACAGG + Intergenic
1085016288 11:73176218-73176240 GCTCTGGGTCTGACACCACCTGG - Intergenic
1089525024 11:119091496-119091518 GCGCATGGGCTGGCACAACCGGG + Exonic
1091589945 12:1836980-1837002 GCTCATGGCCTGGCAGATCCAGG + Intronic
1093088179 12:14890036-14890058 ACTCATGGGCTGAAACTTCCAGG + Intronic
1102205580 12:111088716-111088738 GCTCAGGGCCTGACACTCCCAGG - Intronic
1102236065 12:111295482-111295504 GCTTGGGGTCTGCCACATCCAGG + Intronic
1102244593 12:111347560-111347582 GATCAAGGTCTGGCTCATCCTGG - Exonic
1104128674 12:125872053-125872075 ACTCATGGTGTGCCCCATCCAGG - Intergenic
1104544925 12:129701957-129701979 GCTCATCGTCTCACAAAGCCGGG - Intronic
1106477004 13:30107663-30107685 GCTCATGGTCTGACACATCCAGG - Intergenic
1109337526 13:61011096-61011118 GCTCAGGAGCTGACACAACCAGG - Intergenic
1113356452 13:109585454-109585476 GCTCAAGTCCTAACACATCCCGG + Intergenic
1113765397 13:112877798-112877820 GCCTGTGGTCAGACACATCCGGG - Intronic
1125725282 15:41865290-41865312 GCTGATTATCTGCCACATCCAGG + Intronic
1128216793 15:65940007-65940029 GCACAGTGTCTGACACATACTGG - Intronic
1128341228 15:66823848-66823870 GCTCTTGGTCTCCCACTTCCTGG - Intergenic
1131068276 15:89448169-89448191 GTTCAGGGTCTGACACATGGTGG + Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133234473 16:4381537-4381559 GCTGGTTGTCGGACACATCCAGG - Exonic
1133297530 16:4762237-4762259 GCTCCTGGTCTGCAGCATCCTGG - Intronic
1135136977 16:19892188-19892210 GCTCTGGGGCTGGCACATCCAGG - Intergenic
1136061943 16:27732639-27732661 GCTCAAGGGCTGACTCCTCCAGG - Intronic
1142155166 16:88529686-88529708 GCAGGTGGTCTGGCACATCCAGG + Intronic
1146533977 17:33633793-33633815 CCTCAGGGTCTGACACAATCGGG + Intronic
1148050594 17:44768204-44768226 GCCCATGGCCTGAACCATCCTGG - Intronic
1149647739 17:58252400-58252422 GTCCATGGTCTGAGACCTCCTGG - Exonic
1151620009 17:75239726-75239748 GCTCTGGTTCTGACACATTCAGG + Intronic
1162883588 19:13679065-13679087 GCAGATGGTCTGACACAAGCAGG + Intergenic
1165441181 19:35828959-35828981 GCTGATGCTCTGGCACCTCCTGG - Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1168301362 19:55407100-55407122 GCTGATGGCCTGAAGCATCCTGG - Intronic
929342336 2:40836537-40836559 GCTTATTGTCTGTCACCTCCAGG - Intergenic
930103423 2:47620155-47620177 GTTAATGGTCCAACACATCCTGG + Intergenic
930535373 2:52639089-52639111 GTTCCTGGTCTGTCACAGCCTGG - Intergenic
937208259 2:120250888-120250910 GCTCAGGGTCTGGCATGTCCAGG + Intronic
945844730 2:214930497-214930519 TCTCATGGTCTGACAGCTTCTGG + Intergenic
946005239 2:216519419-216519441 GCTCATGGTCTGAGAGCACCAGG - Intronic
946155815 2:217806046-217806068 GCTCATGGTCTGAGCCAGCTGGG - Intronic
946417118 2:219545518-219545540 GCTCATGCTCTGACAAACTCTGG + Intronic
947793875 2:232882431-232882453 GTCCAGGGTCTGACACATACAGG + Intronic
1171170952 20:23015038-23015060 GCTCATGGTGTTCCCCATCCTGG - Intergenic
1174132224 20:48353377-48353399 TCTCATGGGGTGTCACATCCAGG + Intergenic
1174174377 20:48635785-48635807 GCTCAGGGCCTGGCACATCGTGG + Intronic
1174589702 20:51635353-51635375 GCTCAGGGTCTCTCACAGCCTGG - Intronic
1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG + Intronic
1183506457 22:38211807-38211829 GCTCAGCCTCTGACACATTCTGG - Intronic
1184250796 22:43259048-43259070 GCTGATGTTGTGAAACATCCTGG - Intronic
949412329 3:3779380-3779402 GCTCCTGGTCTGAGAGATACTGG + Intronic
950954744 3:17040180-17040202 GCTCAGGGTCTCACACATAGAGG + Intronic
954254162 3:49392205-49392227 GCTCCTGGCCTCAGACATCCTGG - Intronic
956514985 3:70036689-70036711 GCTCTTGATTTGACTCATCCTGG - Intergenic
959531160 3:107435139-107435161 GCTCAGAGTCTGACACATAATGG - Intergenic
961107749 3:124256674-124256696 GCTCCAGGTCTGATAGATCCAGG - Intronic
961388616 3:126538531-126538553 GCTCATGCCCTGACACAGCCGGG + Intronic
962887723 3:139642832-139642854 ATTTATGGTCTGACACAGCCTGG + Intronic
969105228 4:4802457-4802479 GCTCTTGGCTTGACGCATCCTGG - Intergenic
973255817 4:48112168-48112190 TCTCATTCTCTCACACATCCTGG + Intronic
975370556 4:73581390-73581412 GCACAGGGTCTGACACATTGCGG - Intronic
985346998 4:189016708-189016730 GGTCATGGTCTGAGACTTCAAGG - Intergenic
988506206 5:31825542-31825564 GGTCATGTTCTAATACATCCTGG + Intronic
990294791 5:54390049-54390071 AGCCATGGTCTGACACAGCCAGG - Intergenic
994613212 5:102072160-102072182 GCACATGGTCTAGCACATGCGGG - Intergenic
997580369 5:135013095-135013117 GCTCTGGGTCTGACAGGTCCAGG + Intergenic
998823633 5:146079597-146079619 GCTCATGGTCTGGCTGATGCTGG - Exonic
1002418400 5:179132691-179132713 GCTGAGGGCCTGACTCATCCTGG - Intronic
1003854687 6:10261162-10261184 GCTGCTGCTCTGGCACATCCAGG - Intergenic
1004943814 6:20589907-20589929 GCTCTTGGACTTACACAGCCTGG - Intronic
1007623678 6:43229945-43229967 GCTCAAGGTCAGACAGAACCAGG + Intergenic
1009994767 6:70885862-70885884 GGTCCTGCTCTGACACATACAGG - Intronic
1010559101 6:77325894-77325916 CCTCCTAGTCTGACACATACAGG + Intergenic
1010695232 6:78965075-78965097 GCATATGGCCTGACACATTCAGG - Intronic
1027197045 7:76037772-76037794 GCTCATGGTCTGGCTTCTCCAGG - Intronic
1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG + Intergenic
1029162869 7:98565021-98565043 GCAAATGGACTAACACATCCTGG + Intergenic
1034272746 7:149811283-149811305 CCTGATGGTCTCACAGATCCTGG + Intergenic
1042949352 8:74185011-74185033 GCTCTTGATCTGTCCCATCCTGG + Intergenic
1046942402 8:119943729-119943751 GCTCCTGGTCTGACAGAACGGGG - Intronic
1052414638 9:28161979-28162001 AGTCATAGTCTGAGACATCCAGG + Intronic
1056721035 9:89072239-89072261 GCTCAAGGTCAGACATAACCAGG - Intronic
1057779453 9:98037581-98037603 GATCATGTTCTGTCACCTCCAGG - Intergenic
1193312631 X:80025707-80025729 GCTGATGATCTGCCGCATCCAGG - Exonic
1195942589 X:110178175-110178197 GTTCATGGTCCGACCCATGCTGG - Intronic
1196692532 X:118576176-118576198 GCACATGCCCTGCCACATCCTGG + Intronic