ID: 1106479065

View in Genome Browser
Species Human (GRCh38)
Location 13:30123391-30123413
Sequence TCTGGGGCCCAGCAGCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106479062_1106479065 -7 Left 1106479062 13:30123375-30123397 CCCTCAAAACTGCAGCTCTGGGG No data
Right 1106479065 13:30123391-30123413 TCTGGGGCCCAGCAGCCTCCTGG No data
1106479064_1106479065 -8 Left 1106479064 13:30123376-30123398 CCTCAAAACTGCAGCTCTGGGGC No data
Right 1106479065 13:30123391-30123413 TCTGGGGCCCAGCAGCCTCCTGG No data
1106479058_1106479065 0 Left 1106479058 13:30123368-30123390 CCCTATTCCCTCAAAACTGCAGC No data
Right 1106479065 13:30123391-30123413 TCTGGGGCCCAGCAGCCTCCTGG No data
1106479059_1106479065 -1 Left 1106479059 13:30123369-30123391 CCTATTCCCTCAAAACTGCAGCT No data
Right 1106479065 13:30123391-30123413 TCTGGGGCCCAGCAGCCTCCTGG No data
1106479057_1106479065 1 Left 1106479057 13:30123367-30123389 CCCCTATTCCCTCAAAACTGCAG No data
Right 1106479065 13:30123391-30123413 TCTGGGGCCCAGCAGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106479065 Original CRISPR TCTGGGGCCCAGCAGCCTCC TGG Intergenic
No off target data available for this crispr