ID: 1106482723

View in Genome Browser
Species Human (GRCh38)
Location 13:30148903-30148925
Sequence CAGGAAGCTCTCCTGGCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106482715_1106482723 14 Left 1106482715 13:30148866-30148888 CCTTGAGAGCCCTTGGACATATA No data
Right 1106482723 13:30148903-30148925 CAGGAAGCTCTCCTGGCGTGAGG No data
1106482717_1106482723 4 Left 1106482717 13:30148876-30148898 CCTTGGACATATACCATACGTTC No data
Right 1106482723 13:30148903-30148925 CAGGAAGCTCTCCTGGCGTGAGG No data
1106482721_1106482723 -9 Left 1106482721 13:30148889-30148911 CCATACGTTCTGGGCAGGAAGCT No data
Right 1106482723 13:30148903-30148925 CAGGAAGCTCTCCTGGCGTGAGG No data
1106482716_1106482723 5 Left 1106482716 13:30148875-30148897 CCCTTGGACATATACCATACGTT No data
Right 1106482723 13:30148903-30148925 CAGGAAGCTCTCCTGGCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106482723 Original CRISPR CAGGAAGCTCTCCTGGCGTG AGG Intergenic
No off target data available for this crispr