ID: 1106483715

View in Genome Browser
Species Human (GRCh38)
Location 13:30155245-30155267
Sequence CGGGGTGTCCTTGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106483715_1106483729 19 Left 1106483715 13:30155245-30155267 CCCTCCTCCTCAAGGACACCCCG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1106483729 13:30155287-30155309 GGAGCACAGGGAGAAAGCACAGG 0: 1
1: 0
2: 2
3: 52
4: 459
1106483715_1106483728 7 Left 1106483715 13:30155245-30155267 CCCTCCTCCTCAAGGACACCCCG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1106483728 13:30155275-30155297 GATCTAGAGGATGGAGCACAGGG 0: 1
1: 0
2: 0
3: 18
4: 205
1106483715_1106483724 -2 Left 1106483715 13:30155245-30155267 CCCTCCTCCTCAAGGACACCCCG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1106483724 13:30155266-30155288 CGGCCTCCTGATCTAGAGGATGG 0: 1
1: 0
2: 1
3: 6
4: 107
1106483715_1106483720 -6 Left 1106483715 13:30155245-30155267 CCCTCCTCCTCAAGGACACCCCG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1106483720 13:30155262-30155284 ACCCCGGCCTCCTGATCTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 99
1106483715_1106483727 6 Left 1106483715 13:30155245-30155267 CCCTCCTCCTCAAGGACACCCCG 0: 1
1: 0
2: 2
3: 28
4: 239
Right 1106483727 13:30155274-30155296 TGATCTAGAGGATGGAGCACAGG 0: 1
1: 0
2: 1
3: 11
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106483715 Original CRISPR CGGGGTGTCCTTGAGGAGGA GGG (reversed) Intergenic
900005778 1:49343-49365 TGGGGTCTACTTGAGGACGACGG + Intergenic
900035069 1:401053-401075 AGGGGTGTTCTTGAGTAGGAGGG - Intergenic
900056688 1:636806-636828 AGGGGTGTTCTTGAGTAGGAGGG - Intergenic
900608919 1:3536243-3536265 AGGGGTGTCGTAGAGGAGGGTGG - Intronic
900764582 1:4495235-4495257 CGGGGTGTGTATGTGGAGGAAGG + Intergenic
900947769 1:5840980-5841002 GGGGCTGTCCTTGAGCAGGGAGG - Intergenic
901137062 1:7004681-7004703 GTGGTTGTCTTTGAGGAGGATGG - Intronic
901216723 1:7559274-7559296 CCGTGTGCCCTTGAGAAGGACGG - Intronic
901480301 1:9520501-9520523 GGGAGTGTCCTCGTGGAGGACGG - Intergenic
904463099 1:30692209-30692231 TGGGGTGTCCTGCAGGAGAATGG + Intergenic
905256897 1:36690672-36690694 AGGGGTGCCCTTGGGGAGGAGGG - Intergenic
906480288 1:46194929-46194951 GGCTGTGTCCTTGAGGTGGAAGG + Exonic
906829949 1:49020593-49020615 GGGGGTGTCCTGGAGGAGGAGGG + Intronic
907770213 1:57454492-57454514 CGGGGTCTACTTGAGGATGGAGG + Intronic
909701573 1:78530253-78530275 CAAGGTGTCCTTCAGAAGGATGG - Intronic
910096352 1:83526440-83526462 AGGGCAGTACTTGAGGAGGAAGG - Intergenic
910727405 1:90353325-90353347 AGGGGTGTCAATGAGAAGGAAGG + Intergenic
911063025 1:93764172-93764194 TGGGGTGTTCTGGTGGAGGAGGG - Intronic
911244864 1:95505640-95505662 GGGGGTTTACTTGAGGAGGGAGG - Intergenic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
912714322 1:111971666-111971688 CTGGGTGTCCTTGAGGTGTTTGG - Intronic
913524150 1:119675363-119675385 CTGGGTGTCCTTGGGAAGGGAGG - Intronic
914697964 1:150102854-150102876 TGGGGTCTACTTGAGCAGGAAGG + Intronic
914834991 1:151199282-151199304 TTGGTTGTCTTTGAGGAGGACGG + Intronic
915772406 1:158441538-158441560 CTGGGTGGCAATGAGGAGGAAGG - Intergenic
922257598 1:223906609-223906631 AGGGGTGTTCTTGAGTAGGAGGG - Intergenic
923563937 1:235062681-235062703 AGGGGTGTGCATGTGGAGGAAGG - Intergenic
924338790 1:243009388-243009410 AGGGGTGTTCTTGAGTAGGAGGG - Intergenic
1064138782 10:12772733-12772755 CAGGTTGTCCTGGAGGAGGCTGG + Intronic
1064898346 10:20264302-20264324 TGGGGTCTGCTTGAGGGGGAAGG + Intronic
1065300667 10:24318392-24318414 TGAGGTTTCCTTGAGGAGGAGGG + Intronic
1067735640 10:48848187-48848209 CTGGCTGCCCTTGAGGAAGAAGG - Intronic
1067905370 10:50285299-50285321 CAGGGTGGCCTTGAGGAAGTGGG - Intergenic
1070620479 10:78005913-78005935 CTGGTGGTCCTTGAGGAGTAAGG - Intronic
1071448853 10:85775522-85775544 TGGGGACTCCTAGAGGAGGAAGG + Intronic
1074364046 10:112843990-112844012 TGGGGTGTTCAGGAGGAGGAAGG + Intergenic
1074382950 10:112995140-112995162 AGGGGTTCCCCTGAGGAGGAGGG - Intronic
1076358951 10:129873294-129873316 GGGGGTGTCCCCGAGGTGGAAGG - Intronic
1076749933 10:132537570-132537592 CTTGGTGTCCTTGTGGAGGCGGG - Intergenic
1076900436 10:133335184-133335206 GGGGGTGCCGCTGAGGAGGAGGG + Intronic
1077002811 11:333078-333100 CGGGTTGCCCTTGAGGAAGCAGG + Intergenic
1077177147 11:1196145-1196167 GGGGGGGACCTGGAGGAGGAGGG + Intronic
1077292663 11:1805643-1805665 CCGCGTGTCCTTGATGAGGGTGG - Intergenic
1077292683 11:1805773-1805795 CCGCGTGTCCTTGATGAGGGTGG - Intergenic
1077383306 11:2257452-2257474 CGGGGTACCCTGGAGGAGGCAGG - Intergenic
1077969737 11:7176855-7176877 CTGGGTGTCATTGCAGAGGATGG - Intergenic
1078151208 11:8761017-8761039 AGGGCTTTCTTTGAGGAGGAGGG - Intronic
1079082036 11:17420469-17420491 CTGGGTTTCCTGGAGGAGGCAGG - Intronic
1081228752 11:40558860-40558882 TGGGGTCTACTTGAGGTGGAGGG - Intronic
1082795220 11:57374097-57374119 TGGGGTCTCCTTGAGGGTGAAGG + Intergenic
1082857689 11:57823592-57823614 AAGGATGTCCTTGAGGTGGAAGG + Intergenic
1083212430 11:61196321-61196343 GAGTGTGTCCTTGAGCAGGAAGG - Intergenic
1083634121 11:64110942-64110964 CGGGCTGGCCTTGGGGAGGGGGG + Intronic
1084084605 11:66849239-66849261 CTGGGTGTCCTTGACCAAGATGG + Exonic
1084540324 11:69782365-69782387 CTGGGAGACCCTGAGGAGGAGGG - Intergenic
1086124873 11:83340156-83340178 TGGGGTCTAGTTGAGGAGGAGGG - Intergenic
1089014238 11:115153675-115153697 CGGGCTTTCCTTGCGGTGGAGGG - Intergenic
1089110837 11:116054701-116054723 CTGGGTGCCGTTGGGGAGGAGGG + Intergenic
1090898499 11:131003502-131003524 CAGGGTCTCCTTGAGGACAAAGG - Intergenic
1091796265 12:3299048-3299070 GGGGGTGTCCATGAAGAGCAAGG - Intergenic
1095041159 12:37442419-37442441 CGGGGAGCTCTTGAGGAGCAAGG - Intergenic
1097670314 12:62529010-62529032 TGGGGTGTACTTGAGGCGGGAGG - Intronic
1102933007 12:116876752-116876774 TGGGGAGGCCTGGAGGAGGATGG - Intronic
1104595523 12:130117731-130117753 ACAGGAGTCCTTGAGGAGGAAGG + Intergenic
1104770995 12:131364245-131364267 GGGGGTGTCCTTGAGCTGGGAGG + Intergenic
1106224478 13:27774669-27774691 TGGGGTGTCCTTCAGAAGCAAGG - Intergenic
1106483715 13:30155245-30155267 CGGGGTGTCCTTGAGGAGGAGGG - Intergenic
1106872590 13:34037801-34037823 CTGTGTGTCCTGGAAGAGGAGGG - Intergenic
1114212716 14:20629006-20629028 CAGGATGTCCTTGATGAGGGAGG - Intergenic
1115463323 14:33686109-33686131 CAGGCTGGCCTTGATGAGGAGGG + Intronic
1116049601 14:39787150-39787172 TGGGCTGCCATTGAGGAGGATGG + Intergenic
1117439335 14:55745442-55745464 TGGGGTGTCAATGAGGAGGAAGG + Intergenic
1118777203 14:68980122-68980144 CGGGGTGTCTGTGAGGAGGAGGG - Intergenic
1119131531 14:72177343-72177365 CAGGGTGTCTTTGAGCAGGGAGG + Intronic
1119886992 14:78151664-78151686 CAGGGTGTGGTTCAGGAGGAAGG - Intergenic
1120377852 14:83732320-83732342 TGGGGTCTACTTGAGGAGGGAGG + Intergenic
1120389957 14:83893838-83893860 CAGGGTGACCTTGAAGAGAATGG - Intergenic
1120593765 14:86408094-86408116 AGGGGTGACCTTGAAGAGAATGG + Intergenic
1121410228 14:93744390-93744412 CAGGGTGCCCTTGCGGAGGCCGG + Intronic
1122262450 14:100531123-100531145 GGGGGTGTCCTGGAGGGGGCTGG + Intergenic
1122778537 14:104133845-104133867 CGAGGCCTCCTTGAGGAGAAGGG + Intergenic
1125919550 15:43517564-43517586 AGGGGGGTGCTTGATGAGGAGGG - Intronic
1127022083 15:54759601-54759623 CTTGGTGTCCTTGTGGAGAAGGG - Intergenic
1128684187 15:69671578-69671600 CGGGGTGGTCTTGATGAGAAAGG - Intergenic
1128684385 15:69672707-69672729 CGGGGTGGTCTTGATGAGAAAGG + Intergenic
1129693832 15:77729344-77729366 CTGAGGGTCCTTGAGGAGGAGGG + Intronic
1129769079 15:78192290-78192312 CAGTGTGGCCTTGGGGAGGATGG - Intronic
1130381913 15:83378966-83378988 CGGGGTGGGGGTGAGGAGGAGGG + Intergenic
1131117605 15:89804464-89804486 GTGGGGGTCCTTGAGGAGGGAGG - Intronic
1132027821 15:98417892-98417914 CTGGGTGTCCCTGGGGAGGATGG - Intergenic
1132447737 15:101941579-101941601 TGGGGTCTACTTGAGGACGACGG - Intergenic
1132470478 16:100088-100110 CTGAGTGTCCTTGGGGAGGCCGG - Intronic
1132504728 16:302077-302099 TGGGGTGGCCCTGAGGAGGCTGG - Intronic
1132973059 16:2698300-2698322 CGGGGAGACCCTGAGGTGGATGG + Intronic
1134812458 16:17179223-17179245 CAGGGTCTCCTTGAGGAGGCAGG + Intronic
1136428714 16:30185125-30185147 AGGGGTGTCCTGGGGGAGGTGGG + Intronic
1136746528 16:32596360-32596382 CCGGCTGGCCTTGATGAGGATGG - Intergenic
1137564660 16:49525488-49525510 CGGGTTTTCCTTGCAGAGGAAGG - Exonic
1141331959 16:83118929-83118951 GGGGCTGACCTTGAGGAAGAAGG - Intronic
1141709132 16:85687932-85687954 CTGGGAGTCCTGGAGAAGGAGGG - Intronic
1142145405 16:88490939-88490961 CCTGGTGTCCCTGAGGAGAAGGG - Intronic
1203048657 16_KI270728v1_random:855564-855586 CCGGCTGGCCTTGATGAGGATGG - Intergenic
1142485578 17:245811-245833 CGGGGAGTCCCTCAGGAGGAGGG - Intronic
1143167185 17:4902639-4902661 CAGGGTGACCTTGAGGCTGATGG + Exonic
1144685608 17:17224054-17224076 CAGGCTGTCCTTGATGAAGAAGG + Exonic
1147326524 17:39672353-39672375 AGTGGTGTCCTGGAGGAGGGTGG + Exonic
1147843566 17:43389347-43389369 CGGGGTGCTCTGGAGGAAGATGG + Intergenic
1148820963 17:50359415-50359437 TGGGGTACCCTAGAGGAGGAGGG + Intronic
1148838936 17:50482397-50482419 CGGGCTGTCCTTCGGGAGGCTGG + Exonic
1152407320 17:80105059-80105081 CAGGATGTCCTTGGGGAAGAAGG - Intergenic
1152461247 17:80443642-80443664 TGGGCTGTCCTGGAGGAGGGAGG + Intergenic
1152531750 17:80922974-80922996 CGGGGTGTCCGGGAGGGAGAGGG - Intronic
1152640544 17:81447500-81447522 CCGGGTGCCCTTGAGGACGAGGG + Exonic
1152918123 17:83052340-83052362 CGGGGTGTCATCCAGGAGGAAGG + Intergenic
1156032713 18:32731473-32731495 TGGGGTCTACTTGAGGGGGAGGG + Intronic
1156263503 18:35466476-35466498 GGGGGTGTCCAGGAGGGGGATGG - Intronic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1160637537 19:90954-90976 TGGGGTCTACTTGAGGACGATGG + Intergenic
1161105470 19:2441669-2441691 CGGGACGTCCTTGCGGAGGGAGG + Intronic
1161186182 19:2922526-2922548 AGGGTTTTCCTTCAGGAGGAAGG - Intergenic
1161810476 19:6468433-6468455 GGGGGTGTCCTGGGTGAGGATGG + Exonic
1162066039 19:8126091-8126113 CAAGTTGTCCTTGAGGAGGAAGG + Intronic
1163604023 19:18264480-18264502 CGAGGCGGCCTTGGGGAGGATGG + Exonic
1163668301 19:18613233-18613255 GGGGGTGTCCGTGGGGAGGTGGG + Intronic
1163676094 19:18656033-18656055 GGGGGTGTTCTAGATGAGGAAGG - Intronic
1165355028 19:35299370-35299392 CGGGGTGACCAAGAGGAGGAAGG + Intronic
1165993214 19:39827473-39827495 AGGGGTGTGCTGGAGGTGGAGGG - Intronic
1166361468 19:42254500-42254522 CGGGATGGCCTCTAGGAGGAGGG - Intronic
1166830789 19:45638628-45638650 GGGGGTGTCCTGGCAGAGGATGG - Exonic
1167446213 19:49539105-49539127 CAGGGTTTCCTGGAGGAGAAAGG - Exonic
1168326168 19:55539555-55539577 CGGGCTGGCCTTGGTGAGGAAGG + Intergenic
926855374 2:17250810-17250832 CAGGGTGTGCTTGATGAGGAGGG - Intergenic
927881990 2:26695440-26695462 CTGGGAGGCTTTGAGGAGGAGGG - Intronic
930563801 2:52994685-52994707 TGGGGTCTACTTGAGGGGGAAGG + Intergenic
932234787 2:70112330-70112352 GGGGGTGTCAGTGGGGAGGAGGG - Intergenic
933441539 2:82320854-82320876 TGGGGTGTTCTTGAAAAGGAAGG + Intergenic
935330362 2:101973194-101973216 CATGGCGCCCTTGAGGAGGAGGG + Intergenic
938444558 2:131367032-131367054 AGGGCTGGGCTTGAGGAGGAAGG - Intergenic
939874759 2:147564974-147564996 AGGGGTCTACTTGAGGTGGAAGG + Intergenic
941213915 2:162681317-162681339 CTGGGTGACCTTTAGGAAGAAGG + Intronic
943793607 2:191964493-191964515 CGGAGAGCCCTTGAGGATGATGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944919472 2:204396312-204396334 CCGGGTGACCTTGAGTATGAAGG + Intergenic
946431133 2:219627886-219627908 CGGGGAGCCCTGGGGGAGGAGGG - Intronic
948053929 2:234997461-234997483 CCTGGTGTCCTTCAGGATGAAGG + Intronic
948128465 2:235582651-235582673 CGGAGTGTACTTCAGAAGGAAGG + Intronic
948809633 2:240467987-240468009 TGGGGGGACCTTGTGGAGGAAGG - Exonic
949021196 2:241742364-241742386 CGGCGTGTCCTTGGGGATGGTGG + Intronic
1168813260 20:720025-720047 CTGGGTGCCCCTGGGGAGGAAGG + Intergenic
1169325207 20:4670252-4670274 TGGGATGACCTTGAGCAGGAAGG - Intergenic
1169859377 20:10135355-10135377 GGGGGTGTGCCTGAGCAGGATGG + Intergenic
1170704532 20:18733314-18733336 CAGGGTGTCCTTAAGCAGAAAGG + Intronic
1171149265 20:22812434-22812456 AGGGGTGTCCTTCAGGAGATAGG + Intergenic
1172987126 20:39000688-39000710 CTGGGTTTCCTGGAGCAGGATGG + Intronic
1173418164 20:42876943-42876965 CGGGGTTTGATTTAGGAGGAAGG + Intronic
1175486917 20:59353442-59353464 TGGGGTGTCCTGGAGGAGAGGGG + Intergenic
1175958532 20:62623471-62623493 GGGGGTGTGCGTGAAGAGGAGGG + Intergenic
1176024502 20:62978837-62978859 GGAGGGGTCCCTGAGGAGGAGGG - Intergenic
1178795139 21:35737049-35737071 TGGGGTCTACTTGAGGGGGAGGG + Intronic
1180027457 21:45175928-45175950 CAGGGCGTTCTTGGGGAGGACGG - Exonic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1181418249 22:22775779-22775801 CTGGATGTCAATGAGGAGGAAGG - Intronic
1181500509 22:23313223-23313245 CTTGGTCTCCTTGAGGAGTAGGG - Intronic
1181705730 22:24648534-24648556 CTTGGTCTCCTTGAGGAGTAGGG - Intergenic
1184236903 22:43187414-43187436 CGGGGGGGCCGGGAGGAGGACGG - Intergenic
1184477360 22:44728906-44728928 AGGAGTGGCCTTGAGGTGGAGGG + Intronic
1184808206 22:46810109-46810131 CTGGGTGTTCTGGAGGAGGGAGG + Intronic
950828093 3:15846728-15846750 CTGGGTGTGCCTGAGGAGGCTGG + Intronic
951871736 3:27369358-27369380 CGCGGTGTCCCTGAGGTTGAGGG - Exonic
952121947 3:30255709-30255731 TGGGGTCTACTTGAGGGGGAGGG + Intergenic
952958536 3:38575645-38575667 CGGGCACTCTTTGAGGAGGATGG + Intronic
952974241 3:38680649-38680671 AGGGATCTCCTTGAGGATGATGG - Intergenic
955636976 3:61040977-61040999 GGGGATGTCCTAGGGGAGGAAGG - Intronic
955916423 3:63912422-63912444 GGGGGTGGCCTTGAGGAGGCGGG + Intronic
961819388 3:129567483-129567505 CGGGCTGACCTTGGGGAAGAAGG + Exonic
966579105 3:181539544-181539566 TGGGGTGTACTTGAGGGTGAGGG + Intergenic
968818020 4:2831767-2831789 CGGGGGGTCCTTGCTCAGGACGG - Intronic
969600286 4:8172006-8172028 CAGGGAGTCCTTGAAGAGAAAGG + Intergenic
969694849 4:8728681-8728703 TGGGGTGGCCTTGGGCAGGAGGG + Intergenic
971306793 4:25490070-25490092 TAGGGTGTACTTGAGGGGGATGG + Intergenic
972201488 4:36718570-36718592 GGAGGTGTCCTAGAGGAGGATGG + Intergenic
973212365 4:47631003-47631025 TGGGGTGAGCTAGAGGAGGAGGG + Intronic
977961832 4:103094857-103094879 AGGGCTATCCTAGAGGAGGAGGG + Intronic
979238326 4:118425850-118425872 AGGGGTGTTCTTGAGTAGGAGGG + Intergenic
982105300 4:152006701-152006723 TGAGGTGACCTTGAGGATGAAGG + Intergenic
982156359 4:152525463-152525485 TGGGGTCTACTTGAGGGGGAGGG - Intronic
984056322 4:174933631-174933653 TGGGGTCTCCTTGAGGATGGAGG - Intronic
984698082 4:182799409-182799431 CGGGATCACCTTGAGGGGGAGGG + Intronic
984828099 4:183946393-183946415 CTCGGTGTCCATGAGGAGGGGGG + Intronic
985708653 5:1415781-1415803 GGGTGTGTCCTTGTGGAGGGAGG + Intronic
985730349 5:1543969-1543991 CGGGGGCTCAGTGAGGAGGAAGG - Intergenic
986805118 5:11301942-11301964 AGTTGTGTCCTTGAGGAAGAGGG + Intronic
989458515 5:41669381-41669403 CTGTGAGTCCTTGAGGATGAAGG + Intergenic
991180740 5:63747805-63747827 CTTGGTGTCCTTGTGGAGGGTGG + Intergenic
993031691 5:82713789-82713811 TGGGGATGCCTTGAGGAGGAAGG - Intergenic
993620862 5:90166289-90166311 GGGGGTGTACTTGACGGGGATGG - Intergenic
995404984 5:111784922-111784944 CTGGGTGTGCTTGAGCAGGGGGG + Intronic
995775058 5:115716213-115716235 CGGGGCCTACTTGAGGGGGAGGG - Intergenic
998210626 5:140194570-140194592 AGGGGTACCCTTGAGGAGGTGGG - Exonic
1001985981 5:176074753-176074775 CTGGCTGGCCTTGATGAGGACGG - Intronic
1002001129 5:176196810-176196832 CTGGGTGTGCATGTGGAGGAAGG - Intergenic
1002230889 5:177763371-177763393 CTGGCTGGCCTTGATGAGGACGG + Intronic
1002253206 5:177942162-177942184 CTGGGTGTGCATGTGGAGGAAGG + Intergenic
1002264448 5:178020377-178020399 CTGGCTGGCCTTGATGAGGACGG - Intronic
1002738750 5:181417818-181417840 AGGGGTGTTCTTGAGTAGGAGGG + Intergenic
1004767580 6:18748036-18748058 AGGTGTGCCCTTGAGGAGGAGGG + Intergenic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1006439145 6:34042535-34042557 CGTCCTGTCCTTGAGGAAGAAGG - Intronic
1006672378 6:35737394-35737416 CAGGGTGGGCTTGAGGAAGATGG - Intronic
1007865944 6:44971020-44971042 CTGTGTATCCTTGGGGAGGATGG - Intronic
1011371367 6:86640404-86640426 CATGATATCCTTGAGGAGGAAGG - Intergenic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1018107526 6:160503222-160503244 AGAGGTGTCCTTGGGAAGGATGG + Intergenic
1019189766 6:170245039-170245061 TGGGGGGCCCGTGAGGAGGATGG - Intergenic
1019243855 6:170693370-170693392 AGGGGTGTTCTTGAGTAGGAGGG + Intergenic
1019290156 7:246284-246306 CAGGGTGGCCCTGAGGAGGCTGG + Intronic
1019338125 7:494631-494653 CGGGGGATCCGTGAGGGGGATGG + Intergenic
1019609386 7:1929251-1929273 AGAGGTGTCTTTGGGGAGGAGGG - Intronic
1019951234 7:4374551-4374573 GAGGATGACCTTGAGGAGGAAGG - Intergenic
1022796510 7:33735665-33735687 CTGAGTGTCAGTGAGGAGGATGG - Intergenic
1024671592 7:51600477-51600499 CTGGGTGTCCCTGGGGAGGCTGG + Intergenic
1029126028 7:98295754-98295776 CGGGGTGTGCTTGGGGTGGGTGG - Intronic
1029222388 7:99000726-99000748 TGGGGTGTCCTGAAGGAGCAGGG + Intronic
1029458428 7:100682544-100682566 CGGGATGGCCCTGAGGGGGAAGG - Intronic
1029707293 7:102282661-102282683 AGGGGTGGCCTTGAGGCGAACGG + Intronic
1030156771 7:106463303-106463325 TGGGGAGTCCCAGAGGAGGATGG + Intergenic
1031268634 7:119615567-119615589 TGGGGTCTCCTTGAGGAAGGAGG - Intergenic
1032782048 7:135171071-135171093 CCTCGTGTGCTTGAGGAGGATGG + Intergenic
1033630811 7:143155719-143155741 AGGAGTGTCCTAGAGGAGCATGG - Intergenic
1033927187 7:146477917-146477939 CCGTGTGTGCTTGTGGAGGACGG - Intronic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034994002 7:155566537-155566559 AGGGGTGCCCTGGTGGAGGATGG + Intergenic
1035179498 7:157078655-157078677 CCAGGTGTCCTTGTAGAGGAGGG + Intergenic
1035247864 7:157576625-157576647 AGGAGGGACCTTGAGGAGGAAGG + Exonic
1035504269 8:114790-114812 AGGGGTGTTCTTGAGTAGGAGGG - Intergenic
1038035444 8:23682785-23682807 CAGGATGTCCTGGATGAGGAAGG + Exonic
1047292422 8:123541580-123541602 CGGGGTGGGCGTGAGGAGCAGGG + Intergenic
1048303115 8:133265859-133265881 CTGGTTGACCTTGAGGAGGGCGG - Intronic
1049010902 8:139886768-139886790 TGGTGTGGCCTTGAGGATGAAGG + Intronic
1049774882 8:144399636-144399658 CTCCGTGTACTTGAGGAGGAGGG + Exonic
1049849219 8:144821795-144821817 GAGGGTGTCCTAGAGGAGGGAGG - Intergenic
1051182263 9:14423920-14423942 CGGGTTGCCCTTGTGAAGGATGG - Intergenic
1054706519 9:68468184-68468206 CCGGGTCTTCTTGAGGAGTAGGG - Intronic
1054928318 9:70610707-70610729 CGGGGAGTCCTCCAGGAAGAAGG - Exonic
1055100858 9:72463801-72463823 TGGGGTGTACTTGAGAGGGAGGG + Intergenic
1057182583 9:93038006-93038028 GGGGGTGGCCTTGGGGAGAAAGG - Intergenic
1060886225 9:127154291-127154313 CAGGGTGTCCTGGAGAAGGGTGG + Intronic
1061158833 9:128881917-128881939 CGGGGTGTACTTGGGAACGAGGG - Exonic
1061502573 9:131012510-131012532 CAGGATGTCTTTGAGGAGGCAGG - Intronic
1061908072 9:133708896-133708918 GGGGGGTTCCTTGATGAGGAGGG - Intronic
1062102914 9:134737818-134737840 CTGGGTGTGCTTGAGGCAGATGG + Intronic
1203604043 Un_KI270748v1:42593-42615 AGGGGTGTTCTTGAGTAGGAGGG + Intergenic
1190599191 X:52072000-52072022 TGGGGTCTCCTTAAGGGGGAGGG - Intergenic
1190609633 X:52182073-52182095 TGGGGTCTCCTTAAGGGGGAGGG + Intergenic
1192216667 X:69164165-69164187 AGGGATGTGCTTGAGGTGGATGG + Intronic
1193479225 X:82006864-82006886 CGGGGTATACTTGAGGATGAAGG - Intergenic
1194077586 X:89415919-89415941 TGGGGTCTACTTGAGGAGGTAGG + Intergenic
1194080700 X:89461052-89461074 TGGGGTATACTTGAGGATGAGGG + Intergenic
1197621326 X:128752976-128752998 TGGGGTCTACTTGAGGAGGGAGG - Intergenic
1198195313 X:134354792-134354814 TGGGGTCTACTTGAGGAGGGAGG - Intergenic
1198302082 X:135343213-135343235 CTGGGCCTCCTTGAGGAAGATGG + Exonic
1199150551 X:144480228-144480250 TGGGGTGTACTTTAGGTGGAGGG - Intergenic
1199473662 X:148222576-148222598 CGGGGTCTACTTGAGGTGAAGGG - Intergenic
1200430235 Y:3071463-3071485 TGGGGTCTACTTGAGGAGGTAGG + Intergenic
1200433372 Y:3117255-3117277 TGGGGTATACTTGAGGATGAGGG + Intergenic
1200483471 Y:3737104-3737126 CGGGGTCTACTTGAGGGGGCAGG + Intergenic
1202386101 Y:24327642-24327664 AGGGGTGTTCTTGAGTAGGAGGG + Intergenic
1202484685 Y:25342486-25342508 AGGGGTGTTCTTGAGTAGGAGGG - Intergenic