ID: 1106483810

View in Genome Browser
Species Human (GRCh38)
Location 13:30155701-30155723
Sequence CATCCAAGGTGGTGCCCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106483810 Original CRISPR CATCCAAGGTGGTGCCCGGG TGG Intergenic
905617138 1:39408998-39409020 CTTCCAGGGGGCTGCCCGGGCGG + Intronic
907319598 1:53594321-53594343 CAGGCAGGGTGGTGGCCGGGCGG - Exonic
915305598 1:154975700-154975722 CCTCCAAGGCGGTGGCGGGGCGG - Intronic
915636380 1:157189888-157189910 CATCCAGGCTGGAGCCAGGGAGG + Intergenic
919417931 1:197334561-197334583 CATCCAAGATGGTGCCATGAAGG - Intronic
921186779 1:212677381-212677403 CAAACAAGGTGGTGCCTGTGGGG + Intergenic
921202938 1:212824364-212824386 CATCAACAGTGGTCCCCGGGAGG + Intergenic
1067048953 10:43001118-43001140 CATCCAGGGTGGTGTGCAGGGGG - Intergenic
1069596978 10:69678494-69678516 AATCAAAGATGGTGCCTGGGAGG - Intergenic
1069757411 10:70781786-70781808 CATCCAAGGTAGGGCCTGGCTGG - Exonic
1070747748 10:78945010-78945032 CATCCAAGGTTGTGCTTAGGAGG - Intergenic
1073182481 10:101593194-101593216 GATCCAAGGTACTGCCTGGGAGG - Intronic
1077364875 11:2157589-2157611 CACCCAAGGTGGTGCCTGACAGG + Intronic
1077417719 11:2432626-2432648 CACCCAAGGATGTGCCTGGGGGG - Intergenic
1081865355 11:46356666-46356688 CATCCAGGGTGGAGCCTGAGGGG + Intronic
1082010959 11:47449281-47449303 CGCCCAAGGGGGTGCCCAGGTGG - Intergenic
1087679912 11:101209159-101209181 AATCCTAGGTGGTGGCCGAGTGG + Intergenic
1089561659 11:119346244-119346266 CATCCCAGGGGGTGACCTGGGGG - Intronic
1089787379 11:120917690-120917712 CATGGAAGGAGTTGCCCGGGGGG + Intronic
1090071708 11:123549861-123549883 CAGCCCAGGTGCTGCCCTGGGGG + Intronic
1091795517 12:3295536-3295558 CCTCCAAGCAGGGGCCCGGGAGG + Intergenic
1096974547 12:55692702-55692724 CATAGGAGGGGGTGCCCGGGAGG - Intronic
1098281868 12:68870245-68870267 CCTCCATGGTGGTGCCCTCGTGG - Exonic
1103723454 12:122986631-122986653 TCTCCGAGGTGGGGCCCGGGAGG - Exonic
1104908876 12:132230077-132230099 CATCCAAGGTGGGGCACAGAGGG + Intronic
1106483810 13:30155701-30155723 CATCCAAGGTGGTGCCCGGGTGG + Intergenic
1106552447 13:30783944-30783966 CATCCAAGCTGGTTTCTGGGAGG - Intergenic
1106799531 13:33242221-33242243 CAGACAGGGTGGTGGCCGGGTGG - Intronic
1107815802 13:44243406-44243428 CATCCAAGGCTGTGCTGGGGTGG + Intergenic
1119768749 14:77207085-77207107 CAGCCATGATGGTGCCCAGGGGG - Intronic
1119919480 14:78433068-78433090 CAATCAAGGTGTTGCCTGGGTGG + Intronic
1121954667 14:98203067-98203089 CTTCCAAGGTGGTGCCTCGTTGG + Intergenic
1122861528 14:104584706-104584728 CATCCAGGGGGGTGGCGGGGAGG - Intronic
1122886509 14:104712769-104712791 CACCCCGGGTGGTGCCCGCGCGG + Intronic
1122999958 14:105288038-105288060 CAACAAAGGTGGTGCCGGGACGG + Intronic
1124004659 15:25786113-25786135 CAGGCAAGGTCGTGCCCAGGCGG + Intronic
1126929793 15:53634806-53634828 CAACCAAGGTGGTGCCAGTAGGG + Intronic
1128851652 15:70963821-70963843 CATCAAAGGTGATGTCCGAGAGG - Exonic
1133262859 16:4563337-4563359 CCTCCAGGGTTGAGCCCGGGAGG - Intronic
1136774495 16:32864429-32864451 CATCCAGTGTGGTCCCCTGGAGG - Intergenic
1136896117 16:33997085-33997107 CATCCAGTGTGGTCCCCTGGAGG + Intergenic
1138965792 16:62082592-62082614 CTTCCAAGATGGTGCCTTGGTGG + Intergenic
1140469689 16:75207087-75207109 CACCGAAGGTGGTACCCAGGAGG + Exonic
1203076922 16_KI270728v1_random:1126565-1126587 CATCCAGTGTGGTCCCCTGGAGG - Intergenic
1143595141 17:7909478-7909500 AATCCAAGGGGGTGCCAGGTCGG - Intronic
1144627383 17:16851146-16851168 GATCCAAGGTCCTGCCGGGGCGG - Intergenic
1144879058 17:18421566-18421588 GATCCAAGGTCCTGCCGGGGCGG + Intergenic
1145153178 17:20522821-20522843 GATCCAAGGTCCTGCCGGGGCGG - Intergenic
1145202254 17:20956906-20956928 CAGCCAACGTGGAGCCAGGGTGG - Intergenic
1145204402 17:20974873-20974895 CATCCAGAGAGGTGCCCTGGTGG - Intergenic
1150389044 17:64780426-64780448 CTTCCGAGGTGGTGCCGGAGAGG + Intergenic
1151450408 17:74195321-74195343 CATCAAAGGTGGTGTCTGGATGG - Intergenic
1152022909 17:77790427-77790449 CAGCCAAGGTGCTGGCCGGGTGG - Intergenic
1152049813 17:77964427-77964449 GATGCAAGTTGGTGCCCAGGTGG + Intergenic
1152778621 17:82216744-82216766 CATGCAGGCTGGTGCCCAGGCGG - Intergenic
1155498626 18:26465801-26465823 CATCGGAGATGGTGCCGGGGTGG + Intronic
1161262893 19:3347243-3347265 GATCCCAGGTGGTGCCTGGGAGG - Intergenic
1161508283 19:4656239-4656261 CATCAAGGATGATGCCCGGGTGG - Intronic
1163297508 19:16421813-16421835 CTTCCAAGTGGGTGCTCGGGAGG - Intronic
1163660079 19:18571739-18571761 CATCCAAGATGGCGGCAGGGCGG + Intronic
1164536008 19:29087146-29087168 ACTCCAGGGTGGTGGCCGGGAGG + Intergenic
1165751850 19:38264991-38265013 CATCCACGGTGAGGGCCGGGCGG + Exonic
1166569030 19:43781991-43782013 CATCCAGGATGATGCCCTGGGGG + Intergenic
1168494659 19:56839039-56839061 CATCAAAGATGGCGCCCAGGCGG + Intronic
1168693728 19:58393388-58393410 CATCAACAGTGGTCCCCGGGAGG + Exonic
925239050 2:2306140-2306162 CATCCCAGGTTTTGCCCTGGTGG + Intronic
929626641 2:43415598-43415620 TATCCAAGGTTGGGCCAGGGTGG + Intronic
932446062 2:71782358-71782380 CAGCCAAGGTGGGGCTCTGGGGG + Intergenic
939981481 2:148787279-148787301 CATCCCAGGTGTTGGGCGGGGGG + Exonic
940797741 2:158098408-158098430 CATCCAAGATGGTGAGGGGGAGG + Intronic
947564620 2:231185933-231185955 CTTCCAAGCTGGTTCCAGGGAGG + Intergenic
948464938 2:238147826-238147848 CGTCCAGGGTGGTGCCTGTGGGG - Exonic
1169068905 20:2709746-2709768 CACCCAACCTGGTGCCCCGGGGG - Intronic
1172175133 20:32967582-32967604 CATCCCAGGTAGGGCCTGGGTGG - Intergenic
1173947190 20:46960937-46960959 CATCCCAGGAGGTGCCTGGGAGG + Intronic
1175311934 20:58018347-58018369 CATCAGAGCTGGTGCCGGGGTGG - Intergenic
1175958480 20:62623242-62623264 CAGCCAAAGGGCTGCCCGGGTGG + Intergenic
1178616254 21:34135677-34135699 CATCAATGGTGGTCCCCAGGAGG - Intronic
1179658014 21:42857398-42857420 CACCCAGGGTGGGGCCCGAGGGG - Intronic
1180144885 21:45913502-45913524 CATCCCAGGAGGGGCCCCGGTGG + Intronic
1180161708 21:46001164-46001186 CAGCCAAGGAGGGGCCAGGGCGG + Intronic
1183724106 22:39578897-39578919 CATCACAGGTGGTGCCCAGCAGG - Intronic
1184921819 22:47610531-47610553 CACCTAAGGTGGTGCCCATGCGG - Intergenic
1185193681 22:49454803-49454825 CCTCCCAGCTGCTGCCCGGGCGG + Intronic
1185394354 22:50579124-50579146 CCTCCAAGGTCCTGCCCTGGAGG + Exonic
952903775 3:38126561-38126583 CCTCCATGGTGGTGCTGGGGCGG + Exonic
954384707 3:50237971-50237993 CCTCCAAGGCTGTGCCCCGGAGG - Intronic
954583409 3:51715750-51715772 CATCTTCGGTGGGGCCCGGGAGG + Exonic
957524794 3:81366477-81366499 CATTCAAGATGGAGCCCAGGTGG + Intergenic
961652327 3:128422727-128422749 CTGACAAGGAGGTGCCCGGGAGG + Intergenic
961933476 3:130558271-130558293 CCTCCAAGGTCATGCTCGGGAGG - Intergenic
962876741 3:139541057-139541079 AATCCAAGTTGCTGCCTGGGAGG - Intergenic
968066856 3:195763603-195763625 CATCCAAGGTGGTGATGTGGGGG + Exonic
969658178 4:8509933-8509955 CACCCAAGGGGGTGGCCAGGTGG + Intergenic
972379871 4:38509814-38509836 CCTCCATGGTGGTGCCAGGTTGG - Intergenic
980459550 4:133089994-133090016 GATCCAAGTTGGTGCCTGTGTGG + Intergenic
985203820 4:187511133-187511155 CTTGCAAAGTGGTGCACGGGTGG - Intergenic
985778258 5:1856753-1856775 GAGCCAAGGTGGAGCCGGGGTGG - Intergenic
986802143 5:11272614-11272636 CATCGTAGGTGGTCCCCAGGTGG + Intronic
1002167603 5:177358114-177358136 CACCCAGGGTGGAGCCCAGGAGG + Intronic
1002311265 5:178315297-178315319 CAGGCAAGGGGGTGCCCGGTGGG + Intronic
1002575127 5:180170085-180170107 CAGGCAAGGTGGTGCCCCAGTGG - Intronic
1008874703 6:56313074-56313096 CATTCAAGGTGGGGCAGGGGAGG + Intronic
1013991480 6:116258746-116258768 CATCAACAGTGGTCCCCGGGAGG - Intronic
1019913520 7:4116129-4116151 CATAGAAGGTGGTGCCGAGGTGG + Intronic
1020257219 7:6508990-6509012 CATCCACGATGGTGACCCGGGGG + Exonic
1034405308 7:150898928-150898950 CATCCCAGGTGGAGGCCGTGAGG - Intergenic
1035377380 7:158414368-158414390 GATCCAGGAGGGTGCCCGGGCGG + Intronic
1035395778 7:158534011-158534033 CATCCCTGATGGAGCCCGGGGGG - Intronic
1035395840 7:158534211-158534233 CATCCCTGATGGAGCCCGGGGGG - Intronic
1035602230 8:903369-903391 CTTCAAAGGTGCTGCCCGGGGGG - Intergenic
1037883031 8:22582063-22582085 AAGCCAAGGTGGGGCCAGGGTGG + Intronic
1043443965 8:80301214-80301236 CATCAACAGTGGTCCCCGGGAGG + Intergenic
1185571601 X:1138851-1138873 CTTCAAAGGTGGTACCCGGGAGG - Intergenic
1187757942 X:22546925-22546947 CCTTCAAGGTAGTGCCCTGGAGG + Intergenic
1188648207 X:32595328-32595350 CATCCAAGGTGATGCTTGTGTGG - Intronic
1195697290 X:107676569-107676591 CTTCCAAGGCTGTGCCAGGGCGG + Intergenic
1200105452 X:153709628-153709650 CATCCAGTGTGGTCCCCTGGAGG + Intronic