ID: 1106487212

View in Genome Browser
Species Human (GRCh38)
Location 13:30182309-30182331
Sequence GCCCCCACCACAACTCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106487210_1106487212 2 Left 1106487210 13:30182284-30182306 CCAAGAGAGCATGCTGGGAAAGC No data
Right 1106487212 13:30182309-30182331 GCCCCCACCACAACTCAAGAGGG No data
1106487207_1106487212 27 Left 1106487207 13:30182259-30182281 CCAAAGGGAGACTCTAGCAAAAC No data
Right 1106487212 13:30182309-30182331 GCCCCCACCACAACTCAAGAGGG No data
1106487206_1106487212 28 Left 1106487206 13:30182258-30182280 CCCAAAGGGAGACTCTAGCAAAA No data
Right 1106487212 13:30182309-30182331 GCCCCCACCACAACTCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106487212 Original CRISPR GCCCCCACCACAACTCAAGA GGG Intergenic
No off target data available for this crispr