ID: 1106487535

View in Genome Browser
Species Human (GRCh38)
Location 13:30185538-30185560
Sequence CCATTGGTGTTTAGCTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106487530_1106487535 1 Left 1106487530 13:30185514-30185536 CCATATCGGGGGGATGTAGTTTT No data
Right 1106487535 13:30185538-30185560 CCATTGGTGTTTAGCTTAAGGGG No data
1106487529_1106487535 6 Left 1106487529 13:30185509-30185531 CCAAACCATATCGGGGGGATGTA No data
Right 1106487535 13:30185538-30185560 CCATTGGTGTTTAGCTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106487535 Original CRISPR CCATTGGTGTTTAGCTTAAG GGG Intergenic
No off target data available for this crispr