ID: 1106503226

View in Genome Browser
Species Human (GRCh38)
Location 13:30349023-30349045
Sequence ACCAGAGGGCTGCACCATTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106503226_1106503236 30 Left 1106503226 13:30349023-30349045 CCCGAATGGTGCAGCCCTCTGGT No data
Right 1106503236 13:30349076-30349098 TGGAGTTATGTTGGATAATTAGG No data
1106503226_1106503232 10 Left 1106503226 13:30349023-30349045 CCCGAATGGTGCAGCCCTCTGGT No data
Right 1106503232 13:30349056-30349078 CCCTATTTCTACAGCCAGACTGG No data
1106503226_1106503234 21 Left 1106503226 13:30349023-30349045 CCCGAATGGTGCAGCCCTCTGGT No data
Right 1106503234 13:30349067-30349089 CAGCCAGACTGGAGTTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106503226 Original CRISPR ACCAGAGGGCTGCACCATTC GGG (reversed) Intergenic