ID: 1106504700

View in Genome Browser
Species Human (GRCh38)
Location 13:30360953-30360975
Sequence TGCCCACAAGAGACCTAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106504688_1106504700 21 Left 1106504688 13:30360909-30360931 CCCAAAGCCAGGGCATTGGAAGG No data
Right 1106504700 13:30360953-30360975 TGCCCACAAGAGACCTAGGGGGG No data
1106504691_1106504700 14 Left 1106504691 13:30360916-30360938 CCAGGGCATTGGAAGGAGAAATC No data
Right 1106504700 13:30360953-30360975 TGCCCACAAGAGACCTAGGGGGG No data
1106504687_1106504700 22 Left 1106504687 13:30360908-30360930 CCCCAAAGCCAGGGCATTGGAAG No data
Right 1106504700 13:30360953-30360975 TGCCCACAAGAGACCTAGGGGGG No data
1106504690_1106504700 20 Left 1106504690 13:30360910-30360932 CCAAAGCCAGGGCATTGGAAGGA No data
Right 1106504700 13:30360953-30360975 TGCCCACAAGAGACCTAGGGGGG No data
1106504693_1106504700 -8 Left 1106504693 13:30360938-30360960 CCTCTAAGGAGTCCCTGCCCACA No data
Right 1106504700 13:30360953-30360975 TGCCCACAAGAGACCTAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106504700 Original CRISPR TGCCCACAAGAGACCTAGGG GGG Intergenic
No off target data available for this crispr