ID: 1106505770

View in Genome Browser
Species Human (GRCh38)
Location 13:30369347-30369369
Sequence GCTTTGTAAACAGATCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106505770_1106505780 30 Left 1106505770 13:30369347-30369369 CCAGGGGGATCTGTTTACAAAGC No data
Right 1106505780 13:30369400-30369422 TGTAATCCCAGTGCTTTGGGAGG No data
1106505770_1106505776 26 Left 1106505770 13:30369347-30369369 CCAGGGGGATCTGTTTACAAAGC No data
Right 1106505776 13:30369396-30369418 CCCCTGTAATCCCAGTGCTTTGG No data
1106505770_1106505772 -9 Left 1106505770 13:30369347-30369369 CCAGGGGGATCTGTTTACAAAGC No data
Right 1106505772 13:30369361-30369383 TTACAAAGCAACTCGGAGCCAGG No data
1106505770_1106505778 27 Left 1106505770 13:30369347-30369369 CCAGGGGGATCTGTTTACAAAGC No data
Right 1106505778 13:30369397-30369419 CCCTGTAATCCCAGTGCTTTGGG No data
1106505770_1106505773 -4 Left 1106505770 13:30369347-30369369 CCAGGGGGATCTGTTTACAAAGC No data
Right 1106505773 13:30369366-30369388 AAGCAACTCGGAGCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106505770 Original CRISPR GCTTTGTAAACAGATCCCCC TGG (reversed) Intergenic