ID: 1106505772

View in Genome Browser
Species Human (GRCh38)
Location 13:30369361-30369383
Sequence TTACAAAGCAACTCGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106505770_1106505772 -9 Left 1106505770 13:30369347-30369369 CCAGGGGGATCTGTTTACAAAGC No data
Right 1106505772 13:30369361-30369383 TTACAAAGCAACTCGGAGCCAGG No data
1106505769_1106505772 2 Left 1106505769 13:30369336-30369358 CCATGCTGCTGCCAGGGGGATCT No data
Right 1106505772 13:30369361-30369383 TTACAAAGCAACTCGGAGCCAGG No data
1106505763_1106505772 20 Left 1106505763 13:30369318-30369340 CCTCATGAATTTCATCCTCCATG No data
Right 1106505772 13:30369361-30369383 TTACAAAGCAACTCGGAGCCAGG No data
1106505768_1106505772 5 Left 1106505768 13:30369333-30369355 CCTCCATGCTGCTGCCAGGGGGA No data
Right 1106505772 13:30369361-30369383 TTACAAAGCAACTCGGAGCCAGG No data
1106505762_1106505772 21 Left 1106505762 13:30369317-30369339 CCCTCATGAATTTCATCCTCCAT No data
Right 1106505772 13:30369361-30369383 TTACAAAGCAACTCGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106505772 Original CRISPR TTACAAAGCAACTCGGAGCC AGG Intergenic