ID: 1106505773

View in Genome Browser
Species Human (GRCh38)
Location 13:30369366-30369388
Sequence AAGCAACTCGGAGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106505770_1106505773 -4 Left 1106505770 13:30369347-30369369 CCAGGGGGATCTGTTTACAAAGC No data
Right 1106505773 13:30369366-30369388 AAGCAACTCGGAGCCAGGTGTGG No data
1106505763_1106505773 25 Left 1106505763 13:30369318-30369340 CCTCATGAATTTCATCCTCCATG No data
Right 1106505773 13:30369366-30369388 AAGCAACTCGGAGCCAGGTGTGG No data
1106505762_1106505773 26 Left 1106505762 13:30369317-30369339 CCCTCATGAATTTCATCCTCCAT No data
Right 1106505773 13:30369366-30369388 AAGCAACTCGGAGCCAGGTGTGG No data
1106505768_1106505773 10 Left 1106505768 13:30369333-30369355 CCTCCATGCTGCTGCCAGGGGGA No data
Right 1106505773 13:30369366-30369388 AAGCAACTCGGAGCCAGGTGTGG No data
1106505769_1106505773 7 Left 1106505769 13:30369336-30369358 CCATGCTGCTGCCAGGGGGATCT No data
Right 1106505773 13:30369366-30369388 AAGCAACTCGGAGCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106505773 Original CRISPR AAGCAACTCGGAGCCAGGTG TGG Intergenic