ID: 1106505776

View in Genome Browser
Species Human (GRCh38)
Location 13:30369396-30369418
Sequence CCCCTGTAATCCCAGTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106505774_1106505776 -6 Left 1106505774 13:30369379-30369401 CCAGGTGTGGTGTCTCACCCCTG No data
Right 1106505776 13:30369396-30369418 CCCCTGTAATCCCAGTGCTTTGG No data
1106505770_1106505776 26 Left 1106505770 13:30369347-30369369 CCAGGGGGATCTGTTTACAAAGC No data
Right 1106505776 13:30369396-30369418 CCCCTGTAATCCCAGTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106505776 Original CRISPR CCCCTGTAATCCCAGTGCTT TGG Intergenic