ID: 1106505780

View in Genome Browser
Species Human (GRCh38)
Location 13:30369400-30369422
Sequence TGTAATCCCAGTGCTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106505770_1106505780 30 Left 1106505770 13:30369347-30369369 CCAGGGGGATCTGTTTACAAAGC No data
Right 1106505780 13:30369400-30369422 TGTAATCCCAGTGCTTTGGGAGG No data
1106505774_1106505780 -2 Left 1106505774 13:30369379-30369401 CCAGGTGTGGTGTCTCACCCCTG No data
Right 1106505780 13:30369400-30369422 TGTAATCCCAGTGCTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106505780 Original CRISPR TGTAATCCCAGTGCTTTGGG AGG Intergenic