ID: 1106511824

View in Genome Browser
Species Human (GRCh38)
Location 13:30419617-30419639
Sequence GCCTGACATTAGGCCCCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106511821_1106511824 -2 Left 1106511821 13:30419596-30419618 CCACTCCACAATATAAGGAAAGC 0: 1
1: 0
2: 1
3: 4
4: 146
Right 1106511824 13:30419617-30419639 GCCTGACATTAGGCCCCAGTAGG 0: 1
1: 0
2: 2
3: 10
4: 139
1106511820_1106511824 -1 Left 1106511820 13:30419595-30419617 CCCACTCCACAATATAAGGAAAG 0: 1
1: 0
2: 0
3: 15
4: 187
Right 1106511824 13:30419617-30419639 GCCTGACATTAGGCCCCAGTAGG 0: 1
1: 0
2: 2
3: 10
4: 139
1106511822_1106511824 -7 Left 1106511822 13:30419601-30419623 CCACAATATAAGGAAAGCCTGAC 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1106511824 13:30419617-30419639 GCCTGACATTAGGCCCCAGTAGG 0: 1
1: 0
2: 2
3: 10
4: 139
1106511818_1106511824 5 Left 1106511818 13:30419589-30419611 CCAGGGCCCACTCCACAATATAA 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1106511824 13:30419617-30419639 GCCTGACATTAGGCCCCAGTAGG 0: 1
1: 0
2: 2
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106511824 Original CRISPR GCCTGACATTAGGCCCCAGT AGG Intergenic
900392765 1:2440915-2440937 GCCTCAGATGAGGCCCCAGGAGG - Intronic
901143140 1:7048513-7048535 GGCTGAGATTAGGGCCCAGCTGG - Intronic
901831474 1:11894923-11894945 GGATGACATGAGGCCCCAGATGG - Intergenic
903539893 1:24090946-24090968 GCCTGCCATGAGGCCCCCGGAGG - Exonic
903687480 1:25142515-25142537 GCCTCCCATTAGTCCCCTGTAGG - Intergenic
906150187 1:43583146-43583168 GCCTGTCAGTAGGGCCCAGCGGG + Intronic
906607312 1:47181359-47181381 GTCTGAGATTAGGCCCCCGGAGG + Intergenic
915656941 1:157368513-157368535 TGCTGACATTTGGCCCCATTTGG + Intergenic
918602908 1:186384402-186384424 ACCTTCCATTAGGCCCCACTTGG + Intronic
923493868 1:234507925-234507947 TCCTGACATTGGGCCACAATGGG + Intergenic
1063859315 10:10290749-10290771 GACAGACATTAGGACCCAGGAGG + Intergenic
1065426854 10:25615194-25615216 GCCTGATAGTATTCCCCAGTGGG - Intergenic
1069044032 10:63723786-63723808 GTCAGGCATGAGGCCCCAGTGGG - Intergenic
1069988321 10:72298834-72298856 GCCTGGCATTGGGCCCAAGCGGG + Intergenic
1076605216 10:131685078-131685100 GGCTGTCATTAGACACCAGTGGG + Intergenic
1077050841 11:566121-566143 GCCTGACCTGTGGCCCCAGAAGG + Intergenic
1087074795 11:94119153-94119175 GACAGGCATTAGGACCCAGTAGG - Intergenic
1091409966 12:232912-232934 GCCTGACATTCTGCCCCAGGGGG + Intronic
1094750730 12:33404232-33404254 GCCTTATATTGGGCCCCAGTGGG - Intronic
1095638285 12:44456876-44456898 GCCTGAAATTAGGTGTCAGTGGG - Intergenic
1095699233 12:45174407-45174429 GACTGACAGTAGGACCCAGAAGG - Intergenic
1098667605 12:73183288-73183310 CCCTCACAACAGGCCCCAGTGGG + Intergenic
1098956858 12:76696888-76696910 GGCAGACATTAGGACCCAGGAGG + Intergenic
1099714301 12:86271262-86271284 TCTTGACATTAGGCCCCTGTTGG - Intronic
1102534445 12:113570109-113570131 GCCTGGCATGAAGCCCCAGCCGG - Intergenic
1103419411 12:120768371-120768393 GCCCAACATTGGGCCCCAGGTGG + Exonic
1105546805 13:21356494-21356516 GACTGACAACAGGCCCCAGAAGG - Intergenic
1106347951 13:28897883-28897905 ACCTCACAACAGGCCCCAGTGGG - Intronic
1106511824 13:30419617-30419639 GCCTGACATTAGGCCCCAGTAGG + Intergenic
1108742426 13:53352016-53352038 GCATGACCTGAGGCCCCAGGGGG + Intergenic
1109272202 13:60267562-60267584 GGCGGACATTAGGACCCAGGAGG + Intergenic
1112070134 13:95841033-95841055 GCCCTCCAATAGGCCCCAGTGGG - Intronic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1114032633 14:18589507-18589529 GGCAGACATCAGGCCCCAGGTGG + Intergenic
1114032676 14:18589690-18589712 GGGTAACATTAGGCCCCTGTAGG + Intergenic
1114075977 14:19161362-19161384 GGTGGACATTAGGCCCCAGGTGG - Intergenic
1114077463 14:19168715-19168737 GGGTAACATTAGGCCCCTGTAGG + Intergenic
1114084702 14:19230848-19230870 GGGTAACATTAGGCCCCTGTAGG - Intergenic
1114084745 14:19231031-19231053 GGCAGACATCAGGCCCCAGGTGG - Intergenic
1114625204 14:24124386-24124408 CCCTGACGCCAGGCCCCAGTGGG + Exonic
1116326184 14:43535697-43535719 GGCGGACATTAGGACCCAGGAGG - Intergenic
1118258195 14:64223492-64223514 GCACGACATGAGGCCCCACTCGG - Intronic
1118550518 14:66944848-66944870 GCCTGCCATTAGGCACCCTTGGG + Intronic
1119483636 14:74974862-74974884 GCCTGGCCTTGGGCCCCACTTGG - Intergenic
1121175452 14:91887516-91887538 GCCTGACTTTTGACCCCAGAAGG - Intronic
1122779054 14:104136025-104136047 GGCTGCGATTATGCCCCAGTCGG + Intergenic
1202896297 14_GL000194v1_random:12659-12681 GGGTAACATTAGGCCCCTGTAGG - Intergenic
1202896343 14_GL000194v1_random:12842-12864 GGCAGACATCAGGCCCCAGGTGG - Intergenic
1124028588 15:25989427-25989449 GCTTGACATTAAACCCCACTTGG - Intergenic
1130716875 15:86343490-86343512 GCTTGAAATGATGCCCCAGTCGG + Intronic
1135732858 16:24908885-24908907 GCCCGAGATCAGGCCCCAGAAGG - Exonic
1144332520 17:14237147-14237169 GGCAGACATCAGGCCCCAGGTGG - Intergenic
1145161688 17:20579408-20579430 GGCAGACATCAGGCCCCAGGTGG + Intergenic
1145790782 17:27625294-27625316 CCCTGACACCAGGCCGCAGTGGG + Exonic
1148104268 17:45111011-45111033 ACTTGACATTAGTCCCCAGAGGG - Exonic
1152008027 17:77694685-77694707 GCCTCACAGAAAGCCCCAGTCGG - Intergenic
1152615694 17:81336851-81336873 GCCTGACACAAGGCCCAAGAAGG + Intergenic
1156898847 18:42277230-42277252 ACCTGACATTACTCACCAGTGGG - Intergenic
1162841504 19:13359718-13359740 GGCTGACATTTGGTCCCATTGGG + Exonic
1164738004 19:30556188-30556210 GCCTGACATTAGACCCCAGGAGG + Intronic
928085639 2:28344810-28344832 GCGTGACATCAGTCCCCAGCTGG - Intergenic
931813131 2:65874203-65874225 GCCTGGCATTGGGCCCCGCTGGG + Intergenic
932406552 2:71516535-71516557 CCCTGACCTGAGGCCCCAGGGGG - Intronic
937111233 2:119368106-119368128 GGCTGTCATCAGGCCACAGTAGG + Intronic
938490570 2:131758883-131758905 GGTGGACATTAGGCCCCAGGTGG - Intronic
938491864 2:131765336-131765358 GGCAGACATCAGGCCCCAGGTGG + Intronic
938491913 2:131765519-131765541 GGGTAACATTAGGCCCCTGTAGG + Intronic
938495651 2:131796823-131796845 GGGTAACATTAGGCCCCTGTAGG - Intronic
938495700 2:131797006-131797028 GGCAGACATCAGGCCCCAGGTGG - Intronic
939118333 2:138087445-138087467 GCCCAACATTAGGCCCCAGATGG + Intergenic
940043498 2:149385456-149385478 GACTGACATTAGGACTCTGTTGG - Intronic
944984113 2:205155189-205155211 GGCTGAATTCAGGCCCCAGTGGG - Intronic
948821777 2:240553459-240553481 GGCTGGCTGTAGGCCCCAGTAGG + Intronic
1172167983 20:32910484-32910506 GCCAGACAAGAGGTCCCAGTGGG - Intronic
1172751128 20:37252038-37252060 GGCTCTCATCAGGCCCCAGTAGG - Intronic
1173365421 20:42380533-42380555 CCCAGACATTGGGCCCCAATCGG + Intronic
1174542635 20:51302040-51302062 GCTAGACACTAGGCCTCAGTAGG - Intergenic
1176615984 21:9028655-9028677 GGGTAACATTAGGCCCCTGTAGG - Intergenic
1176616030 21:9028838-9028860 GGCAGACATCAGGCCCCAGGTGG - Intergenic
1176709126 21:10134899-10134921 GGCAGACATTAGGCCCCAGGTGG + Intergenic
1176709169 21:10135073-10135095 GGGTAACATTAGGCCCCTGTAGG + Intergenic
1178746021 21:35251018-35251040 GCCTAAGATAAGGCCCCAGCAGG - Intronic
1179431108 21:41321849-41321871 GCCTGACAATGGGCCCCACCCGG - Intronic
1180293227 22:10862162-10862184 GGCAGACATCAGGCCCCAGGTGG + Intergenic
1180293270 22:10862345-10862367 GGGTAACATTAGGCCCCTGTAGG + Intergenic
1180456746 22:15516564-15516586 GGCAGACATCAGGCCCCAGGTGG + Intergenic
1180456789 22:15516747-15516769 GGGTAACATTAGGCCCCTGTAGG + Intergenic
1180496031 22:15891584-15891606 GGCAGACATCAGGCCCCAGGTGG + Intergenic
1180496074 22:15891767-15891789 GGGTAACATTAGGCCCCTGTAGG + Intergenic
1181669517 22:24419650-24419672 GCCTGATATGAGGGCCCAGAAGG - Intronic
1182295691 22:29310374-29310396 GGCTGACATTAAGCCCCAGGAGG + Intronic
1184220898 22:43099184-43099206 TCCAGACAGGAGGCCCCAGTGGG - Intergenic
1184328835 22:43812615-43812637 TCCTGACCACAGGCCCCAGTGGG - Intergenic
1185166941 22:49267126-49267148 GCCTGTCGTTAGGCCTCAGCGGG - Intergenic
1203292182 22_KI270736v1_random:5758-5780 CCCTAACATCAGGCCCCAGTGGG - Intergenic
953928792 3:46995898-46995920 GCCTCACATTAGGCCATACTTGG - Intronic
957969371 3:87363522-87363544 GCCTGACATTAGGCCACTCTAGG - Intergenic
968576338 4:1367937-1367959 GCCTGACATGAGGGCCCTGGGGG + Intronic
969274343 4:6124874-6124896 GCCTGACTTTAGGCCACCATCGG + Intronic
969293626 4:6256313-6256335 GCCAGACATGAGGCCACAGCCGG + Intergenic
974410879 4:61539579-61539601 GCCTGGCAGTAAGCCACAGTGGG + Intronic
975001128 4:69224218-69224240 GGCGGACATTAGGACCCAGGAGG + Intergenic
975012727 4:69377016-69377038 GGCGGACATTAGGACCCAGGAGG - Intronic
975742139 4:77439727-77439749 GCCTGCCATTGGGCCTTAGTAGG + Intergenic
979180286 4:117718164-117718186 GCCTGACCTCAGACCCCAGGAGG - Intergenic
985851335 5:2390985-2391007 TTCTGACATTTGGCCCCAGAAGG - Intergenic
989957111 5:50371224-50371246 GGCAGACATTAGGACCCAGGGGG - Intergenic
993437551 5:87916256-87916278 GCCTGGCATTAGGGTCCACTTGG - Intergenic
997072150 5:130634487-130634509 GACAGACATTAGGACCCAGGAGG - Intergenic
997617252 5:135256005-135256027 GCCTTGCATTAGGCACCAGATGG + Intronic
1000944680 5:167406300-167406322 GCCTGACATTAGGCACCCTGTGG + Intronic
1001760650 5:174205362-174205384 CACTTACATTAGGCTCCAGTTGG + Intronic
1003404884 6:5820294-5820316 GACTGACAACAGGCCCCAGAAGG + Intergenic
1004150235 6:13112036-13112058 ACCCTCCATTAGGCCCCAGTGGG + Intronic
1004364919 6:15003810-15003832 GCATGATATTAGGACCCAGGTGG + Intergenic
1015493064 6:133850682-133850704 CCCTGACATTAGCCTACAGTTGG + Intergenic
1017159659 6:151352811-151352833 GCCTGACAGTCGGGCCCTGTGGG - Exonic
1021044116 7:15901547-15901569 GCCTTACATTAGCCTACAGTTGG + Intergenic
1022401873 7:30046337-30046359 GACTGACAGTAGGACCCAGAAGG + Exonic
1025109281 7:56199809-56199831 GCCTGACTTCAGTTCCCAGTAGG - Intergenic
1032267600 7:130380117-130380139 GCCTGGAATGAGGCCCCAGCAGG + Intergenic
1034916266 7:155042319-155042341 GCCTCAAATTAGGCCCCAGTGGG - Intergenic
1038037152 8:23696207-23696229 GCCTGTCTTAATGCCCCAGTTGG - Intergenic
1043552121 8:81386438-81386460 GCCTGACCTGAGACTCCAGTAGG + Intergenic
1045342190 8:101264911-101264933 GCCTGACATGAGGTCCATGTAGG - Intergenic
1049041934 8:140119022-140119044 GCCTGACATTAGACTGCATTTGG - Intronic
1051935002 9:22435442-22435464 GGCTGGCATTAGGACCCAGGGGG - Intergenic
1052603883 9:30672713-30672735 GGCAGACATCAGGCCCCAGGTGG - Intergenic
1053644931 9:40114589-40114611 GGTGGACATTAGGCCCCAGGTGG - Intergenic
1053646098 9:40120418-40120440 GGCAGACATCAGGCCCCAGGTGG + Intergenic
1053646140 9:40120601-40120623 GGGTAACATTAGGCCCCTGTAGG + Intergenic
1053759618 9:41343122-41343144 GGCAGACATCAGGCCCCAGGTGG - Intergenic
1054327109 9:63718315-63718337 GGCAGACATCAGGCCCCAGGTGG + Intergenic
1054327153 9:63718498-63718520 GGGTAACATTAGGCCCCTGTAGG + Intergenic
1054538430 9:66255375-66255397 GGGTAACATTAGGCCCCTGTAGG - Intergenic
1054538472 9:66255558-66255580 GGCAGACATCAGGCCCCAGGTGG - Intergenic
1054539642 9:66261380-66261402 GGTGGACATTAGGCCCCAGGTGG + Intergenic
1056112351 9:83408417-83408439 GCCTGACCCTTGGGCCCAGTGGG - Intronic
1202793886 9_KI270719v1_random:103869-103891 GGCAGACATTAGGCCCCAGGTGG + Intergenic
1202793930 9_KI270719v1_random:104043-104065 GGGTAACATTAGGCCCCTGTAGG + Intergenic
1186446084 X:9630124-9630146 GCCAGACATTAGGCCCCTCCAGG - Intronic
1188789772 X:34393922-34393944 GCCTGAGAATAGGCTCAAGTGGG + Intergenic
1191579947 X:62749691-62749713 TTTTCACATTAGGCCCCAGTGGG + Intergenic
1192509938 X:71715705-71715727 GCCTCACATTAGACACCACTAGG - Intronic
1192516759 X:71765848-71765870 GCCTCACATTAGACACCACTAGG + Intronic
1194350888 X:92824413-92824435 GCCTGACAGTAGGCTCCGGAGGG - Intergenic
1200301265 X:154979306-154979328 GCCTGACCTCAGACCCCAGGAGG + Intronic
1200659214 Y:5941096-5941118 GCCTGACAGTAGGCTCCGGAGGG - Intergenic
1201149372 Y:11087379-11087401 GGGTAACATTAGGCCCCTGTAGG - Intergenic
1201149417 Y:11087562-11087584 GGCAGACATCAGGCCCCAGGTGG - Intergenic
1201562953 Y:15337038-15337060 GCCTGGCATTAGGCCCAAGGAGG + Intergenic
1201730236 Y:17194122-17194144 GCCAGGCATTCTGCCCCAGTAGG - Intergenic