ID: 1106513978

View in Genome Browser
Species Human (GRCh38)
Location 13:30436805-30436827
Sequence AAGAAAGAGGAAAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106513978_1106513983 14 Left 1106513978 13:30436805-30436827 CCAGCCTCCTTTTCCTCTTTCTT No data
Right 1106513983 13:30436842-30436864 CTCCATTGTTAAATAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106513978 Original CRISPR AAGAAAGAGGAAAAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr