ID: 1106517017

View in Genome Browser
Species Human (GRCh38)
Location 13:30464938-30464960
Sequence GGCGGCCCCCACCGCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106517017_1106517034 20 Left 1106517017 13:30464938-30464960 CCCCCGCCGCGGTGGGGGCCGCC 0: 1
1: 0
2: 3
3: 23
4: 305
Right 1106517034 13:30464981-30465003 ACTCCCCGTCTCCCTCCGCGCGG 0: 1
1: 0
2: 2
3: 14
4: 111
1106517017_1106517035 21 Left 1106517017 13:30464938-30464960 CCCCCGCCGCGGTGGGGGCCGCC 0: 1
1: 0
2: 3
3: 23
4: 305
Right 1106517035 13:30464982-30465004 CTCCCCGTCTCCCTCCGCGCGGG 0: 1
1: 0
2: 0
3: 28
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106517017 Original CRISPR GGCGGCCCCCACCGCGGCGG GGG (reversed) Intronic
900168472 1:1254522-1254544 GGCGGCCGCGAGCGGGGCGGGGG - Intronic
901065460 1:6492118-6492140 GGTAGGCCCCACCGCAGCGGGGG + Intronic
901065465 1:6492126-6492148 GGCCGCCTCCCCCGCTGCGGTGG - Intronic
902823162 1:18955890-18955912 GGCGGCCTGCCCCCCGGCGGCGG - Exonic
902918083 1:19650839-19650861 GGCTGCCCCCACCGGTGGGGTGG - Intronic
903205997 1:21783000-21783022 GGCGGTGCAGACCGCGGCGGCGG - Exonic
903398295 1:23019614-23019636 GGCGGCAGCCGCGGCGGCGGCGG + Exonic
904641956 1:31937946-31937968 GGCGGCCCCCGCGCCGGCGCCGG - Intronic
905137141 1:35808398-35808420 GGCGGCCCCCGCCGCCGCCATGG + Exonic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
908355924 1:63324446-63324468 GGCGGCCGCAGCAGCGGCGGCGG - Exonic
908714296 1:67053772-67053794 GGCGGCCCAGGCCGCGGAGGAGG - Intronic
910657430 1:89633063-89633085 GGCGGCTCCGTCCGCGGCCGGGG + Exonic
910787997 1:91021660-91021682 GGCGGCCGCCGCCGCGGGGCGGG - Intronic
910981245 1:92961550-92961572 CGCGGCGCGCGCCGCGGCGGGGG - Intergenic
912514930 1:110211363-110211385 GGCGGCCCCCTCTGCGGCTTGGG - Intronic
913186295 1:116373322-116373344 GGCGGCAGCAACAGCGGCGGCGG + Intronic
914237338 1:145823961-145823983 GGTGGGCCGCACCGAGGCGGCGG - Exonic
914286157 1:146228799-146228821 GGCGGCCGCGGCGGCGGCGGCGG - Exonic
915572370 1:156751534-156751556 GGGGGCCACCATCGAGGCGGGGG - Intronic
917345179 1:174022148-174022170 GGCGGCGGCTGCCGCGGCGGTGG - Exonic
920071792 1:203307445-203307467 GGCGGCGCCCAGGGCGGGGGCGG - Exonic
920309964 1:205043233-205043255 GGCGGCGGCCGCGGCGGCGGTGG - Exonic
920352172 1:205344313-205344335 GCCGGCCTCCTCCCCGGCGGCGG - Exonic
922739344 1:228006821-228006843 GGGAGCCCGAACCGCGGCGGCGG - Intergenic
922753735 1:228082866-228082888 GTCGACCCCCGCGGCGGCGGCGG + Intronic
922802678 1:228371453-228371475 GGCGGCACCCGGCCCGGCGGCGG + Exonic
923007953 1:230067201-230067223 CCCGGCCCCCACCGCGCCCGCGG + Exonic
923042920 1:230332767-230332789 GGCCGAGCCCACCGCTGCGGTGG - Intronic
923506408 1:234609622-234609644 GGCGGCCGCAAAGGCGGCGGCGG + Intergenic
1064384631 10:14879109-14879131 GCCGGCTCCCGCCGCGGAGGTGG + Intronic
1064645377 10:17454342-17454364 GGCTGCGGCCACGGCGGCGGTGG - Intergenic
1064712430 10:18140760-18140782 GTCGCCTCCCACAGCGGCGGCGG + Exonic
1064764760 10:18659563-18659585 CGGGTCCCCCACCGCGGCGCGGG - Exonic
1065712731 10:28533151-28533173 GGCGGCACCAGCGGCGGCGGCGG + Intronic
1066370460 10:34815000-34815022 CGCGGGCCCGCCCGCGGCGGCGG - Exonic
1069386115 10:67884762-67884784 GTCGGCCCCCGCCGCCGAGGGGG - Exonic
1070800778 10:79243337-79243359 GGCTGCCTCCTCGGCGGCGGCGG + Intronic
1071086971 10:81875756-81875778 GGCGGCACCCCCGGCGGAGGGGG - Exonic
1072151847 10:92690234-92690256 GGCAGCGGCCAGCGCGGCGGCGG - Exonic
1072710777 10:97714415-97714437 CGCGGCCCCGATCGGGGCGGGGG + Exonic
1072719505 10:97771940-97771962 GGCGACCTCCGCGGCGGCGGCGG - Exonic
1073266367 10:102230673-102230695 GGCGGCAGCCGCGGCGGCGGCGG + Exonic
1073414234 10:103368113-103368135 AACGGCCCCAACGGCGGCGGCGG + Exonic
1073414263 10:103368204-103368226 GGCCGCCCCCGCCGGGGCAGCGG - Exonic
1076372403 10:129963972-129963994 GGCGGCTCCACCGGCGGCGGCGG + Intergenic
1076923022 10:133465401-133465423 GGCGGCCCCCAGGGCGGCGACGG - Intergenic
1077299914 11:1842094-1842116 GGCTGCCCCCAGCACTGCGGGGG - Intergenic
1077322314 11:1947801-1947823 GGCGGCCCCCACCGCAGCGCGGG + Intronic
1080012498 11:27472565-27472587 CGCGGCCCCCGCCGCTGCGCCGG - Exonic
1081831914 11:46121547-46121569 GGGGGCGCGCACGGCGGCGGCGG - Intergenic
1082050505 11:47767097-47767119 GGCGGCAGTCACCGCGGTGGTGG + Exonic
1083882127 11:65553929-65553951 GGCTGCCCGCACCGCGCCGCGGG + Intronic
1083940129 11:65891237-65891259 GGCGGCCCCAGCGGCGCCGGGGG + Exonic
1083970310 11:66070411-66070433 GGCTTCCCCCGCGGCGGCGGCGG - Intronic
1085205826 11:74731354-74731376 GGCGGTCCCAGCAGCGGCGGCGG + Intronic
1087672751 11:101127544-101127566 GGGGGCCGCCCCGGCGGCGGCGG + Exonic
1088630071 11:111766160-111766182 GGCCACCCCCACCGCGACGCAGG + Intronic
1089046103 11:115503557-115503579 GGCCGCCCCCCCCGCGGGGCCGG + Intronic
1089273418 11:117316370-117316392 GGCGGACTCCACCTCGGCAGAGG - Intronic
1089432713 11:118436692-118436714 GGCGGCCGCGGCGGCGGCGGCGG + Exonic
1089700246 11:120240220-120240242 AGCGGCTCCCGCGGCGGCGGCGG + Intronic
1090199684 11:124845431-124845453 GGTGGCCCCCACAGTGGAGGGGG - Intergenic
1202805332 11_KI270721v1_random:3114-3136 GGCGGCCCCCACCGCAGCGCGGG + Intergenic
1092256309 12:6928228-6928250 GGCGGCCCCGACCCCCCCGGAGG - Intronic
1092743245 12:11649893-11649915 GACGGGCCCGAGCGCGGCGGCGG - Exonic
1093958792 12:25250904-25250926 GGCGGCGGCCGCGGCGGCGGAGG - Intronic
1095225060 12:39669741-39669763 AGGGGCGCCCACCACGGCGGAGG - Intronic
1096077633 12:48815124-48815146 TGCGACCCCGACCTCGGCGGGGG - Intronic
1096241395 12:49961978-49962000 GGCGGCAGCTGCCGCGGCGGGGG - Exonic
1096668137 12:53180731-53180753 GGCTGCCCCCACCGGGACCGAGG - Exonic
1096674925 12:53221216-53221238 GGCGGCCCGGGCCGCGGCGGAGG - Intronic
1097046304 12:56189661-56189683 GGCGGCCTCCCCGGCAGCGGAGG + Intergenic
1097247366 12:57613899-57613921 GGCGGCTCCCACCAGGGAGGGGG + Intronic
1101605889 12:106247631-106247653 GGCGGCCACCGCGGCGGCGGCGG - Exonic
1102370950 12:112382095-112382117 GGCGGCCGCGGCGGCGGCGGCGG - Intronic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1104049494 12:125186280-125186302 GGCGGCCCCTCCCCCGGCCGCGG + Intergenic
1104444714 12:128823865-128823887 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1104891866 12:132144072-132144094 GGCGGCCCCGGCGGCGGCGGCGG - Exonic
1106517017 13:30464938-30464960 GGCGGCCCCCACCGCGGCGGGGG - Intronic
1106735858 13:32586991-32587013 GGCGGCGGCGACGGCGGCGGCGG - Intronic
1107771011 13:43787309-43787331 AGCAGTCCCGACCGCGGCGGCGG - Intergenic
1110705951 13:78602202-78602224 GGCGGCCCGGGCGGCGGCGGCGG - Exonic
1111396301 13:87672624-87672646 CGCGGTCGCCACCGCGGCGGCGG + Exonic
1112050618 13:95641766-95641788 GGAGGCCGCACCCGCGGCGGCGG + Exonic
1112050619 13:95641769-95641791 GGCCGCACCCGCGGCGGCGGCGG + Exonic
1112091874 13:96091076-96091098 GGGGGCCCCCGGGGCGGCGGGGG - Exonic
1112216321 13:97434319-97434341 GGCGGCCCCCTGGGCGCCGGCGG - Exonic
1113789912 13:113022760-113022782 TTGAGCCCCCACCGCGGCGGCGG + Intronic
1113967341 13:114161481-114161503 CGCGGCGGCCACAGCGGCGGGGG + Intergenic
1117675606 14:58152145-58152167 GGCGGGCCCTGCGGCGGCGGCGG + Exonic
1117690261 14:58298884-58298906 GGCGGCTGCAACTGCGGCGGCGG - Intronic
1118720489 14:68590448-68590470 GGCAACCCCCAACGCTGCGGGGG - Intronic
1118992631 14:70809675-70809697 GGCTGCCCCAACCACGGCGGAGG - Intergenic
1121690897 14:95876575-95876597 GGCGACCGCGACCGCAGCGGCGG - Intergenic
1122220979 14:100239073-100239095 GGCGGGCGCCGCGGCGGCGGCGG - Exonic
1122221083 14:100239410-100239432 GGTGGCGACCACGGCGGCGGGGG + Exonic
1122264100 14:100538674-100538696 CGGGGCCGCCACCGCGGCCGTGG + Exonic
1122300145 14:100726871-100726893 GGCGGCGCGCGCGGCGGCGGCGG + Exonic
1122444994 14:101761704-101761726 TGCGGCAGCCACGGCGGCGGCGG - Intergenic
1123024885 14:105419876-105419898 GGCGGCCTCGGCGGCGGCGGCGG + Exonic
1125513817 15:40307106-40307128 GGCTGCCCCCACAGCAGCGCAGG + Intronic
1125742126 15:41972564-41972586 GGCGGCGGCCAGCGCGGCCGGGG - Exonic
1126767002 15:52019437-52019459 GGCGGGCCCGGCGGCGGCGGCGG + Intronic
1128139077 15:65286387-65286409 GGCGGCCGCCAGGGAGGCGGCGG - Exonic
1130651380 15:85763963-85763985 AGGGGCACCCACCGCGGGGGAGG + Intronic
1131094810 15:89648492-89648514 GGCGGCCGCCGCGGAGGCGGTGG + Exonic
1132663799 16:1072812-1072834 GGCGGCACTCACCTGGGCGGCGG - Intergenic
1132781136 16:1626278-1626300 GGCGACCCCCGCAGTGGCGGAGG + Intronic
1133008337 16:2896817-2896839 GGTGGCCCCCACAGCCGCGCTGG + Intronic
1133029608 16:3004207-3004229 GGCGGCCGCAACCGGGGTGGCGG + Intergenic
1133188356 16:4116053-4116075 GCCGGCCCTGCCCGCGGCGGCGG + Exonic
1133784415 16:8963574-8963596 GGCGGGCCCCGCGGCGGCGGCGG - Intronic
1136348991 16:29695003-29695025 GGCGGCCTCCACTGCAGCGGCGG - Exonic
1136566404 16:31073299-31073321 GGCGGCCCCCTCCCCTGCTGAGG - Intronic
1137412927 16:48244630-48244652 GGCTGCCCCCGCGGCGGCGGCGG + Intronic
1137708028 16:50548668-50548690 GGCGGCGGCAGCCGCGGCGGCGG - Intronic
1138478290 16:57284717-57284739 GGCGGCCCCGGCGGCGGGGGCGG - Intergenic
1138656888 16:58496527-58496549 GGCTGCCCCCACGGAGGCAGGGG - Intronic
1139664890 16:68448443-68448465 GGCGGCGGCCGCAGCGGCGGCGG + Exonic
1140927654 16:79599405-79599427 GGCGGACACCACGGCGGCGGCGG + Exonic
1141531370 16:84648812-84648834 GGCGGCCCCTCCCCCGGCCGCGG - Intronic
1142195250 16:88736591-88736613 GGCGGCCCCCTCTGCCGCGCAGG - Intronic
1142763893 17:2055585-2055607 GGCTCCCCTCCCCGCGGCGGTGG - Intronic
1144110003 17:12021467-12021489 AGCGGGGCCCACTGCGGCGGCGG - Intronic
1146398563 17:32487018-32487040 GGCGGCGGCGACGGCGGCGGCGG - Exonic
1149994705 17:61400353-61400375 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
1149994706 17:61400356-61400378 GGCGGCCGCGGCGGCGGCGGCGG + Exonic
1150137595 17:62704162-62704184 GGAGGCCCTCGCCGAGGCGGAGG + Intronic
1150168362 17:62966217-62966239 CGACGCCCCCAGCGCGGCGGCGG + Intergenic
1152222209 17:79075059-79075081 GGCCGCCGCCGCCGCGGCCGCGG - Exonic
1152361236 17:79834096-79834118 AGCGGCACCCACCACGACGGCGG - Exonic
1152520859 17:80855842-80855864 AGCCGCCCCCAGCGCTGCGGAGG + Intronic
1153514490 18:5891374-5891396 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1154416371 18:14177973-14177995 GGCTGCACCGCCCGCGGCGGGGG + Intergenic
1155054459 18:22171669-22171691 GGCGGCAGCAGCCGCGGCGGCGG + Exonic
1157338272 18:46756847-46756869 GGCGGCCCCTCCCGCCGAGGTGG + Exonic
1157533466 18:48441536-48441558 GGCTTCCTCCACCGCGGCAGAGG + Intergenic
1157867053 18:51196768-51196790 GGCGGCCGCGGCGGCGGCGGCGG - Exonic
1157867054 18:51196771-51196793 GGCGGCGGCCGCGGCGGCGGCGG - Exonic
1160698603 19:496158-496180 CGCCGCCCCCACCCCGACGGCGG - Intronic
1160769187 19:822542-822564 GGTGGACCCCGGCGCGGCGGAGG - Intergenic
1160909214 19:1467199-1467221 GCCTGCCCCGAGCGCGGCGGGGG + Exonic
1160930693 19:1568276-1568298 GGCGGCGGCGACGGCGGCGGCGG + Intergenic
1161066328 19:2240177-2240199 GACGCCCCCCACCCCGGGGGAGG - Intronic
1162421674 19:10568992-10569014 GGCGGCTGCCTCAGCGGCGGCGG - Intronic
1162485921 19:10960684-10960706 AGCGGACGCCACTGCGGCGGCGG - Intergenic
1162589000 19:11578596-11578618 GGCGGCGCCCAGCACGGAGGAGG - Exonic
1162959462 19:14117536-14117558 GGCGTTGCCCATCGCGGCGGCGG + Exonic
1163158049 19:15449692-15449714 GGCGGGACCCCCCGGGGCGGGGG - Intronic
1163762574 19:19145673-19145695 GACGCCCCCCTCCGCGGTGGGGG - Exonic
1165803136 19:38565189-38565211 GGCGGCCACGGCGGCGGCGGGGG + Exonic
1166060220 19:40321277-40321299 AGCGGCCCCCTCGTCGGCGGTGG - Exonic
1166104606 19:40591048-40591070 AGCTGCCCCCACCACGGCGCCGG - Exonic
1166133248 19:40759573-40759595 GACAGCCCCCACCACGGGGGTGG - Exonic
1166230211 19:41422155-41422177 CGCCGCCCCCACCGCTGCAGGGG - Exonic
1167154530 19:47730098-47730120 AGCCGCCCCCAGCCCGGCGGGGG - Intronic
1167237171 19:48322055-48322077 GCACGCCCCCTCCGCGGCGGCGG + Intronic
1167268255 19:48493891-48493913 GGCGGCGCCGGGCGCGGCGGCGG - Exonic
1167272073 19:48511450-48511472 GGTGGCCCCCACCCCCGCGGCGG - Intronic
1167466216 19:49652162-49652184 TGCGGCTGCCCCCGCGGCGGCGG - Exonic
1167740726 19:51323591-51323613 GGCTTCCCCCACCGAGGGGGTGG - Intronic
1168073066 19:53963332-53963354 GGGACCCCCCACCGCGGGGGCGG + Exonic
1168339514 19:55615133-55615155 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1168339515 19:55615136-55615158 GGCGGCGGCCGCGGCGGCGGTGG + Exonic
925079726 2:1054284-1054306 GGCGGCCCACACCTGGGCTGTGG + Intronic
925609634 2:5692506-5692528 CGCAGCTCCCACCGCGCCGGCGG + Intergenic
926268116 2:11344472-11344494 GGCGGTCCGGGCCGCGGCGGTGG - Exonic
926982309 2:18584893-18584915 GGCTGCCCGGACAGCGGCGGCGG + Exonic
929857859 2:45651291-45651313 GGCGGTGCGCAGCGCGGCGGCGG - Intergenic
930872774 2:56184702-56184724 CGCGGCCCCGCCCGCGCCGGTGG + Exonic
931695171 2:64865705-64865727 GGCGGCCGCGGCCTCGGCGGCGG + Intergenic
932621869 2:73269454-73269476 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
932621870 2:73269457-73269479 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
932718406 2:74120284-74120306 GACGGCCTCCACGGCGGCAGGGG + Intergenic
932722464 2:74147944-74147966 GGCGGCCTCTCCCACGGCGGCGG - Exonic
932728316 2:74198850-74198872 AGCGGCCACCACCGCCGGGGCGG - Intronic
934031861 2:88055595-88055617 GGCCGCCCCCGCCGCCGGGGCGG + Intronic
934761762 2:96860602-96860624 GGGAACCCCCACCGCGTCGGCGG - Exonic
935112221 2:100104490-100104512 GGCGGCCCGAGCCTCGGCGGCGG - Exonic
936038322 2:109129642-109129664 GGCGGCGGCCACCGCCGCGGGGG + Exonic
936038323 2:109129645-109129667 GGCGGCCACCGCCGCGGGGGCGG + Exonic
938554968 2:132416272-132416294 GGGGGCCCCCAGGGCAGCGGTGG + Intergenic
939998054 2:148938649-148938671 GGGGGCCCCCACTGTGGCTGGGG + Intronic
941816463 2:169800390-169800412 GGCGCCCACCACCACGGCTGCGG - Intronic
942278079 2:174336894-174336916 GGCGGCTGCCACGGCGGCGCTGG - Exonic
942444156 2:176067221-176067243 GGCGGGCCCCACCGCGAACGAGG - Intergenic
942446193 2:176080412-176080434 TGCGGCCTCCTCGGCGGCGGCGG - Exonic
942450917 2:176107626-176107648 GGCGGCCCCGGCGGGGGCGGCGG + Exonic
943725350 2:191246171-191246193 GGCAACCCCCTCCGCTGCGGCGG - Intronic
943875348 2:193060757-193060779 GGCGCCCGCCACCGCGCCCGAGG + Intergenic
944273144 2:197805132-197805154 GGCGCCGCCCGACGCGGCGGGGG + Exonic
946354922 2:219178478-219178500 GGCGGCCACGGCCGAGGCGGTGG + Exonic
947774560 2:232697447-232697469 GGCGGCCCGGGACGCGGCGGCGG - Intronic
1169143493 20:3238663-3238685 CGGGGCTCCCACCGCGGCGCCGG + Intronic
1169445736 20:5669618-5669640 GGAGGCCCCCATAGAGGCGGTGG - Intergenic
1169557619 20:6767687-6767709 GGCGGCGGCGACGGCGGCGGCGG - Exonic
1171278165 20:23876094-23876116 GGTGGCCCCCACCCTGGGGGAGG - Exonic
1175429104 20:58890254-58890276 GGCGGCGGCCGCGGCGGCGGCGG - Intronic
1175795358 20:61767331-61767353 TGCTGCCCCCACCGGGGCTGTGG + Intronic
1175891040 20:62316048-62316070 GGCAGCCCACACTGCGGGGGAGG + Exonic
1175956077 20:62610097-62610119 GGCGGCCCCCACAGCAGGGCGGG - Intergenic
1175992464 20:62796580-62796602 GGCGGCCACCAGCCCGGCGGAGG + Exonic
1176380685 21:6111013-6111035 GGCGGCCCCCGCCCGGGCGGCGG + Intergenic
1176547075 21:8206706-8206728 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1176548599 21:8212238-8212260 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176554980 21:8250915-8250937 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1176556493 21:8256446-8256468 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176566026 21:8389753-8389775 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1176567530 21:8395273-8395295 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176573902 21:8433939-8433961 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1176575432 21:8439488-8439510 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176856960 21:13981293-13981315 GGCTGCACCGCCCGCGGCGGGGG - Intergenic
1178992418 21:37366876-37366898 GGCGGCGGCAACCGCGGCGGGGG + Intronic
1179742787 21:43427227-43427249 GGCGGCCCCCGCCCGGGCGGCGG - Intergenic
1179953169 21:44723289-44723311 GGTGGCCTCCACCGTGGCTGAGG - Intergenic
1180082058 21:45491445-45491467 TGCAGCCCCCACCGAGGAGGTGG - Intronic
1180559231 22:16601991-16602013 GGCGGCGGCGGCCGCGGCGGCGG + Intergenic
1180649956 22:17369505-17369527 GGCGGCCGCCGCCGCAGCCGCGG + Exonic
1181085154 22:20436475-20436497 GCCGGCCCCCGCCCCGGAGGCGG + Intronic
1181283402 22:21735758-21735780 GGCGGCCCGCGGGGCGGCGGCGG - Exonic
1183401735 22:37608957-37608979 GGCGGGCCCCTTCCCGGCGGGGG + Intronic
1183484751 22:38082842-38082864 GGCGGCCCCCGGCGGGGCGAGGG - Exonic
1184465782 22:44668473-44668495 GGCGGCGCCCGCCGGGGCAGGGG - Intergenic
1185248675 22:49787633-49787655 GGCGGCGGCCTCCGCGGTGGCGG - Intronic
1203251950 22_KI270733v1_random:122991-123013 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1203252490 22_KI270733v1_random:124752-124774 ACCGGCCGCGACCGCGGCGGCGG + Intergenic
1203260003 22_KI270733v1_random:168073-168095 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1203261537 22_KI270733v1_random:173621-173643 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
949414386 3:3799857-3799879 CCCGGCACCCACGGCGGCGGCGG - Exonic
950509956 3:13420151-13420173 GGCGGGCCCCTCCGCCGCTGCGG - Exonic
954176231 3:48847811-48847833 GTCGGTCCCCGCGGCGGCGGCGG - Exonic
955161404 3:56468217-56468239 GGCGGCCCCGGCCCCGGCGTCGG + Intronic
955246330 3:57228025-57228047 GGCGGCCCCCACCTGGGCCGGGG - Intronic
962575525 3:136752163-136752185 GGCGGCGGCGACGGCGGCGGGGG - Intronic
963602582 3:147390959-147390981 GGTGGCCTCCTCGGCGGCGGTGG - Exonic
963904468 3:150762690-150762712 CGCGGTGCCCGCCGCGGCGGCGG - Exonic
964569725 3:158098117-158098139 GGCCGCCACTACCGAGGCGGCGG + Exonic
966911419 3:184562254-184562276 GGCGGCGGCGACGGCGGCGGCGG - Exonic
968674711 4:1871341-1871363 GGCGGCCCCGGCTGCGGCGGCGG + Intergenic
970394714 4:15654888-15654910 GGCCGGCCCCACCGCCGCGCTGG - Intronic
971195685 4:24470707-24470729 GACGCCCCCACCCGCGGCGGCGG + Intergenic
972725832 4:41745995-41746017 GGCGGCCGCGGCAGCGGCGGCGG - Exonic
975131881 4:70839555-70839577 GGCGGCCGCGGCCGCGGCAGAGG + Exonic
975342574 4:73258569-73258591 GGCGGGCCCCCCCGCGGCGGCGG - Exonic
976390005 4:84497671-84497693 GGCGGCCACGGCCGCGGCGCTGG + Exonic
977607413 4:98996178-98996200 GGCGGCCCCCGCCCCAGCGCGGG - Intronic
981782375 4:148443709-148443731 GGCGACCCGCAGCCCGGCGGCGG + Intronic
985516457 5:347834-347856 GGGGGCCCCCACCGCAGGAGAGG - Intronic
985647886 5:1093680-1093702 GGCGGCCCGCACCTCGCCGTGGG + Intronic
987088006 5:14487592-14487614 GGCGGCCCCAGCAGCTGCGGCGG + Exonic
990955151 5:61332811-61332833 CCCGGCCCCCGCGGCGGCGGCGG - Exonic
991676556 5:69094286-69094308 GCCGGCCCCGGCGGCGGCGGCGG + Exonic
992105519 5:73447205-73447227 GGCGGCGGCCTGCGCGGCGGCGG + Exonic
992105520 5:73447208-73447230 GGCGGCCTGCGCGGCGGCGGCGG + Exonic
993898777 5:93570763-93570785 TGCGGTCCCCCGCGCGGCGGAGG - Intergenic
997975377 5:138438965-138438987 GGAGGCCGCCGCGGCGGCGGCGG - Intergenic
998130390 5:139648731-139648753 AGCGGAGCGCACCGCGGCGGTGG + Exonic
998517706 5:142770709-142770731 GGCGGCCCGGGCCCCGGCGGAGG + Exonic
1002709140 5:181183657-181183679 GGCGCCCGCCACCGCGCCTGTGG - Intergenic
1003049418 6:2766056-2766078 CGCGCTCCCCGCCGCGGCGGCGG - Exonic
1004561869 6:16760229-16760251 GGCGGCGGCCGCCGCGGAGGAGG - Intronic
1005582948 6:27251073-27251095 CACGGCCCGCACCGGGGCGGAGG - Exonic
1005587158 6:27288170-27288192 CGCGGCCGCAACCGCGGCGAAGG - Intronic
1005669504 6:28091053-28091075 GGCGGCTCCCTCCCCGGAGGGGG + Intergenic
1007680342 6:43629203-43629225 GGCGGCGGCGACGGCGGCGGCGG - Intergenic
1007902044 6:45422026-45422048 GGCGGCCGCCGCGGAGGCGGCGG + Intronic
1012939651 6:105403124-105403146 GGCGGGCCCAGCGGCGGCGGCGG + Intergenic
1013575800 6:111482950-111482972 GGCGGCTCCCTCCGCAGCGGCGG + Exonic
1013793613 6:113860188-113860210 GGCCGCGCCCGCCTCGGCGGCGG - Exonic
1015749991 6:136550109-136550131 GGCGGCCGCAACCCCGGCCGGGG + Intronic
1017470574 6:154733867-154733889 GGAGGCCCCGAGCCCGGCGGCGG - Exonic
1017672026 6:156777858-156777880 GGCGGCGGCGACGGCGGCGGCGG + Intergenic
1017672244 6:156778738-156778760 GGGGGCCCCGGCGGCGGCGGCGG - Exonic
1017672310 6:156778946-156778968 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1017672311 6:156778949-156778971 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
1017672361 6:156779105-156779127 GGCGGCCGCCGGCTCGGCGGCGG + Exonic
1018208561 6:161458422-161458444 GGCTGCCTCCACCGCGGCGAGGG - Intronic
1019111928 6:169724012-169724034 GGGGGCCCGCGCGGCGGCGGCGG - Exonic
1019436988 7:1027677-1027699 GGCGGCCCCCACTGGCGCGGTGG - Intronic
1019474993 7:1240224-1240246 GGCCGCCCTCACCGCGGCCTCGG - Intergenic
1019764993 7:2843753-2843775 GGGGTCCCCGCCCGCGGCGGCGG + Intronic
1020274289 7:6615490-6615512 GGCGGCGGCGACGGCGGCGGCGG + Intergenic
1020281634 7:6653102-6653124 CGCAGCCCCCGCCGCGTCGGTGG - Exonic
1022103808 7:27184604-27184626 GGCGACCTCCGCGGCGGCGGCGG - Exonic
1022106254 7:27199834-27199856 GGCGGCCGCGGCTGCGGCGGCGG - Exonic
1022410304 7:30134900-30134922 GGCGGCCCGCAAGGGGGCGGGGG + Exonic
1022942531 7:35254197-35254219 CGCGGCCCCGCCCCCGGCGGCGG - Intergenic
1023638421 7:42236486-42236508 GGCGGCGGCCCCCGCGGCGGAGG + Intronic
1026968305 7:74453943-74453965 GGCGGCCCCCACCCCCGGCGCGG - Intronic
1027251326 7:76400550-76400572 GGCGGCCCCGGCAGCGGCTGGGG + Exonic
1029715107 7:102321452-102321474 GGCGGGCCCCGACGCGGCAGAGG - Exonic
1029996756 7:105014159-105014181 GGCGGCCGCGGCGGCGGCGGCGG - Exonic
1029996757 7:105014162-105014184 GGCGGCGGCCGCGGCGGCGGCGG - Exonic
1029996758 7:105014165-105014187 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1031317370 7:120273808-120273830 TGCTGCCGCCACGGCGGCGGCGG + Exonic
1033654375 7:143362823-143362845 GGCCGCCCCCTCCCCGGCCGCGG - Intergenic
1034618016 7:152435838-152435860 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1035022750 7:155808871-155808893 GGCTTCCCCCAGCGCGGGGGCGG + Intronic
1037535222 8:19817431-19817453 CGCCGCCGCCACCGCGGGGGAGG - Exonic
1039542295 8:38382211-38382233 GGCGGCCAGCACGGAGGCGGAGG - Exonic
1039868854 8:41528951-41528973 GGCGCCCGCCACCGCGGCCAAGG - Intergenic
1039921478 8:41896828-41896850 GGCGGCTCGTACTGCGGCGGCGG + Intergenic
1044675073 8:94720109-94720131 CGCGGCCGCCACCGCGACCGCGG - Intronic
1049647067 8:143740243-143740265 GGCGGCCCCGACCCCCGCGAGGG - Intergenic
1049707438 8:144049396-144049418 GGCGGCGCCCAGCACAGCGGAGG - Intergenic
1052192794 9:25678185-25678207 GGCAGCCCCAGCGGCGGCGGCGG - Exonic
1053397037 9:37784813-37784835 GGCGGTCCCCACAGCGCCGAAGG + Exonic
1058058486 9:100473024-100473046 GGCGGCGCCGGCCGCGGCCGGGG + Intronic
1059453956 9:114388034-114388056 GGCGGCCTCAACCACGGCAGGGG - Intronic
1061040895 9:128139804-128139826 GGAGGCACCCACCGCGACGCAGG - Intergenic
1061365785 9:130172093-130172115 GGCCCTCCCCGCCGCGGCGGGGG + Intergenic
1061438153 9:130579653-130579675 GGCGGCGGCGACGGCGGCGGGGG + Exonic
1061492918 9:130956197-130956219 GGCCGCCCCCACTGAGGAGGGGG + Intergenic
1062014952 9:134286681-134286703 AGCGGCCCCCACCTGGGAGGTGG - Intergenic
1062400757 9:136371665-136371687 CGGGGCTCCCACCGCAGCGGGGG - Intronic
1062497960 9:136840481-136840503 GGCGGCCGCCACCCTGGGGGTGG + Exonic
1062498990 9:136844312-136844334 GGCGGCCCCCTCCGCAGCCCAGG - Intronic
1062600083 9:137315602-137315624 GTCAGCCCCCACCCCGGGGGAGG + Intronic
1202779769 9_KI270717v1_random:24098-24120 GGCGGGGGCCACGGCGGCGGGGG + Intergenic
1203468353 Un_GL000220v1:106141-106163 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1203469883 Un_GL000220v1:111690-111712 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203476174 Un_GL000220v1:150113-150135 GCGGCCCCCCTCCGCGGCGGTGG + Intergenic
1203477704 Un_GL000220v1:155662-155684 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1185508286 X:644533-644555 GGCGGCGGCGACCACGGCGGCGG - Exonic
1187826175 X:23334753-23334775 GGCGGCGGCGACGGCGGCGGCGG - Exonic
1190440477 X:50470581-50470603 GGCGGCGGCCAAGGCGGCGGAGG + Exonic
1192925004 X:75747091-75747113 GGCGGCCGCGGCGGCGGCGGCGG - Intergenic
1192925005 X:75747094-75747116 GGCGGCGGCCGCGGCGGCGGCGG - Intergenic
1198767089 X:140091328-140091350 GGCGGCGGCGACCGAGGCGGCGG + Intergenic
1200239389 X:154486010-154486032 GGCCACCCCCACGGCGGTGGAGG - Intronic