ID: 1106526678

View in Genome Browser
Species Human (GRCh38)
Location 13:30546836-30546858
Sequence CTACCGTGAATCCACCTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106526675_1106526678 29 Left 1106526675 13:30546784-30546806 CCAGTTTAATTATTCTTTATACA 0: 1
1: 0
2: 5
3: 62
4: 636
Right 1106526678 13:30546836-30546858 CTACCGTGAATCCACCTTTAGGG 0: 1
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106526678 Original CRISPR CTACCGTGAATCCACCTTTA GGG Intronic
903076790 1:20775616-20775638 CTACCATGAATGGACCTTAAAGG - Intronic
909610259 1:77544214-77544236 TTACCATGAATCCAGCTTTCAGG + Intronic
916842812 1:168617256-168617278 CTAGTGTGTATCCTCCTTTAAGG + Intergenic
921506734 1:215980371-215980393 CTACAGTGCATACAACTTTACGG + Intronic
1074941235 10:118237460-118237482 CTACTGAAATTCCACCTTTAGGG - Intergenic
1104606486 12:130193234-130193256 CTCCCTGGAATCCTCCTTTAAGG - Intergenic
1106526678 13:30546836-30546858 CTACCGTGAATCCACCTTTAGGG + Intronic
1108746774 13:53404194-53404216 CTACCATGGATCCACCTTCTGGG + Intergenic
1112646013 13:101332427-101332449 CTACCGTGAGTCGAATTTTAAGG - Intronic
1113685533 13:112280111-112280133 CTTCCCTGAATCCACCCTGAAGG - Intergenic
1113686662 13:112286500-112286522 CTTCCCTGAATCCACCCTGAAGG - Intergenic
1118697117 14:68395980-68396002 GTACCAAGAATCCACCGTTAGGG + Intronic
1125922908 15:43536609-43536631 CTACCCTGAAACCACATCTATGG + Intronic
1133537749 16:6718506-6718528 CCAAAGTGAAACCACCTTTAAGG + Intronic
1159362411 18:67422680-67422702 CGAACATGAATCCACCATTACGG + Intergenic
1163103909 19:15112617-15112639 CTACAGTGATGCCACCTTAAGGG + Intronic
1175953270 20:62595021-62595043 CTACAGTGAATCCAAATTAAGGG - Intergenic
1177904467 21:26958860-26958882 CTTCCGTGGAGACACCTTTATGG - Intronic
1181738237 22:24898680-24898702 CTACAGTGAATCCTCCATGACGG - Intronic
952618263 3:35302082-35302104 CTTCACTGTATCCACCTTTATGG + Intergenic
954538059 3:51376075-51376097 CTGCCCTGAGCCCACCTTTATGG + Intronic
962625048 3:137217588-137217610 CAAACGTGAACCCACCTGTAAGG + Intergenic
966035918 3:175414103-175414125 CTACCGTAAATCCCCCTCTATGG - Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
973237619 4:47922634-47922656 CTACCGAGATTCCACCTCTGGGG - Intronic
977856382 4:101899919-101899941 CTATCCTGAGTCCAGCTTTAAGG + Intronic
980211322 4:129792047-129792069 CTATTTTGGATCCACCTTTAGGG + Intergenic
982463254 4:155697805-155697827 CTTCTGTCAATCCACCTTGAAGG + Intronic
982757719 4:159243013-159243035 CCAGCGTGATTCCCCCTTTATGG + Intronic
988365654 5:30294978-30295000 CTACCCTGAATTCACCATTCAGG - Intergenic
991410500 5:66340989-66341011 CTATCATGAATCCTGCTTTAAGG + Intergenic
994718182 5:103348591-103348613 CTATGGTGAATCCACCATTCTGG + Intergenic
995833702 5:116379934-116379956 CTTCCCTGAAGCCACCTGTAAGG + Intronic
999566749 5:152872216-152872238 GTATTGTTAATCCACCTTTATGG + Intergenic
1001631998 5:173182346-173182368 CTACGGTGATACCATCTTTAAGG + Intergenic
1009988315 6:70808710-70808732 CTATCTGAAATCCACCTTTAAGG - Intronic
1024628329 7:51227427-51227449 CATCCCTGAATACACCTTTAGGG + Intronic
1043405783 8:79931560-79931582 CTACGGTGATTCCTCTTTTACGG - Intronic
1046669584 8:117043013-117043035 CTTATGTGAATCAACCTTTATGG + Intronic
1196662729 X:118284641-118284663 ATACCGTGCATTCATCTTTATGG + Intergenic
1197992606 X:132334195-132334217 CTACCCTGCATCCAGCTTCATGG + Intergenic
1198798507 X:140425452-140425474 CCACAGTAAATGCACCTTTAGGG + Intergenic