ID: 1106534211

View in Genome Browser
Species Human (GRCh38)
Location 13:30624496-30624518
Sequence TAGCCCCAGCTACCCGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 2, 2: 44, 3: 193, 4: 516}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106534211 Original CRISPR TAGCCCCAGCTACCCGGGAG GGG Intronic
900672194 1:3861545-3861567 TAGTCCCAGCTACTCAGGGGCGG - Intronic
901370539 1:8793944-8793966 TAGTCCCACCTACTCAGGAGAGG + Intronic
901651750 1:10747020-10747042 TAGCCCCCGCTAACCAGGAGTGG + Intronic
902457239 1:16543432-16543454 TAGTCCCAGCTACTCCAGAGGGG - Intergenic
902483982 1:16729835-16729857 TAGTCCCAGCTACTCCGGAGGGG + Intergenic
902494928 1:16864479-16864501 TAGTCCCAGCTACTCCGGAGGGG + Intronic
902660064 1:17894823-17894845 TGGTCCCAGCTACTTGGGAGGGG + Intergenic
902782577 1:18714089-18714111 TAGTCCCAGCTACTCGGCTGAGG + Intronic
902950569 1:19879731-19879753 TAGTCCCAGCTATTCGGGAGGGG - Intergenic
903078386 1:20789129-20789151 TAGTCCCAGCTACTCGCGGGAGG + Intergenic
903410026 1:23134659-23134681 TGGTCCCAGCTACTTGGGAGAGG + Intronic
903921966 1:26806110-26806132 TAGTCCCAGCTACTTGGGAGGGG - Intergenic
904154643 1:28472721-28472743 TAATCCCAGCTACTCAGGAGAGG - Intronic
904507449 1:30969780-30969802 TAGTACCAGCTACTCAGGAGAGG - Intronic
904515687 1:31053124-31053146 TAATCCCAGCTACTCAGGAGAGG - Intronic
904530837 1:31168013-31168035 TAATCCCAGCTACCCCGGCGGGG + Intergenic
904707630 1:32403367-32403389 TAACCCCAGCTACTCGGGAGGGG - Intergenic
905877481 1:41442093-41442115 TTATCCCAGCTACTCGGGAGGGG + Intergenic
906393158 1:45436606-45436628 TAATCCCAGCTACTCGGGAGGGG - Intronic
906429960 1:45748548-45748570 TAGTCCCAGCTACTCAGGGGAGG + Intronic
906492889 1:46281786-46281808 GAGTCCCAGCTAGCCGGGAGCGG + Intronic
906945787 1:50293073-50293095 TAATCCCAGCTACTCGGGGGTGG + Intergenic
907039334 1:51244504-51244526 TAGTCCCAGCTACTCGGGACAGG - Intronic
907447172 1:54515810-54515832 TAGCCCTAGCTACTCAGGAGAGG - Intergenic
907663749 1:56416423-56416445 GAGCTCCAGGTACCCAGGAGGGG + Intergenic
908544374 1:65148805-65148827 TAGCCCGAGCCACCCGGCCGAGG + Intronic
909237814 1:73175885-73175907 TTGTCCCAGCTACTCAGGAGTGG - Intergenic
909570237 1:77101882-77101904 TAGTCCCAGCTACTTGGGAGGGG + Intronic
910693561 1:89989300-89989322 TAGTCCCAGCTACTCGGGGAGGG + Intergenic
910875693 1:91875766-91875788 TAATCCCAGCTACTCGGGCGGGG + Intronic
911035618 1:93542903-93542925 TAATCCCAGCTACTCGTGAGAGG - Intronic
912025267 1:105162051-105162073 TAGTCCCAGCTACTCAGGAGAGG - Intergenic
912773100 1:112483057-112483079 TAGTCCCAGCTACCTGGGAGTGG + Intronic
912929298 1:113942178-113942200 TAGTCCCAGCTACTCAGGACAGG - Intronic
912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG + Intronic
913016555 1:114742460-114742482 TAGTCCCAGCTACTCAGGAGGGG + Intronic
913280172 1:117178057-117178079 TAGTCCCAGCTACTTGGGGGAGG - Intronic
913662224 1:121014320-121014342 TAGTCCCAGCTACTCAGGAGGGG - Intergenic
914013601 1:143797505-143797527 TAGTCCCAGCTACTCAGGAGGGG - Intergenic
914164225 1:145163682-145163704 TAGTCCCAGCTACTCAGGAGGGG + Intergenic
914652225 1:149706114-149706136 TAGTCCCAGCTACTCAGGAGGGG - Intergenic
914796974 1:150928175-150928197 TAATTCCAGCTACTCGGGAGGGG - Intronic
915390986 1:155543810-155543832 TAGTCCCAGCTACTTGGCAGGGG + Intronic
916061756 1:161103567-161103589 TAGTCCCAGCTACTCAGCAGAGG + Intronic
916921775 1:169476596-169476618 TAATCCCAGCTACTAGGGAGAGG + Intronic
917305492 1:173619706-173619728 TAATCCCAGCCACTCGGGAGGGG + Intronic
917422617 1:174880709-174880731 TAGTCCCAGCTACTCAGGAGAGG - Intronic
917450918 1:175146724-175146746 TAACCCCAGCTGCCCAGCAGAGG + Intronic
917993691 1:180411785-180411807 TAATCCCAGCTACTCGGGGGAGG - Intronic
918210489 1:182346733-182346755 TAGTCCTAGCTACTCAGGAGTGG - Intergenic
919667253 1:200303953-200303975 TAGTCCCAGCTACTGGGGTGGGG + Intergenic
919996866 1:202760192-202760214 TAGTCCCAGCTACGTGGGGGGGG + Intronic
920132656 1:203744723-203744745 TTGTCCCAGCTACTGGGGAGGGG + Intergenic
920880405 1:209875188-209875210 TAGTCCCAGCTACTTGGGAGGGG + Intergenic
921388267 1:214592805-214592827 TAATCCCAGCTACTTGGGAGAGG + Intergenic
922163760 1:223097734-223097756 AAGCCCCAGCTTCCTGGGAGAGG + Intergenic
922339083 1:224641232-224641254 TAGCCCCACCTGCCGGGGAGGGG + Intronic
923117695 1:230958871-230958893 TAGCCCCAGCTACTTGGTTGGGG + Intronic
923282640 1:232459630-232459652 TAGTCCCAGCTACTCAGAAGGGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923695849 1:236250348-236250370 TAATCCCAGCTACTCGGGAGAGG + Intronic
924213885 1:241799259-241799281 TAGTCCCAGCTGCTTGGGAGAGG + Intronic
924478527 1:244404711-244404733 TAGCCCCAGCTACTCGGGGCGGG - Intergenic
924548302 1:245050984-245051006 TAGTCCCAGCTACTTGGGGGAGG - Intronic
924699061 1:246431608-246431630 CAGTCCCAGCTACTCGGGGGAGG + Intronic
1062821606 10:538274-538296 TAGTCCTAGCTACTTGGGAGTGG - Intronic
1062919304 10:1267159-1267181 CACCCACACCTACCCGGGAGGGG - Intronic
1063519874 10:6731465-6731487 TAGTTCCAGCTACTCAGGAGAGG + Intergenic
1063664129 10:8051611-8051633 GAGGCCCAGGTACCTGGGAGGGG + Intergenic
1064081375 10:12310721-12310743 TGGTCCCAGCTACTCGGGACAGG - Intergenic
1065787249 10:29228025-29228047 TAGTCCCAGCTACAGGGCAGGGG - Intergenic
1066348352 10:34611944-34611966 TAGTCCCAGCTACTCGGGGCGGG - Intronic
1067016868 10:42763745-42763767 TAGTCCCAGCTACTTGGGAGGGG - Intergenic
1067130058 10:43555848-43555870 CAGACCCAGCTACTCAGGAGGGG - Intergenic
1067147115 10:43702008-43702030 TAATCCCAGCTACTTGGGAGAGG - Intergenic
1067202123 10:44182098-44182120 TAGTCTCAGCTACTCGGGAGGGG + Intergenic
1067236524 10:44455074-44455096 TAGTCCCAGTTACTCGGGAGGGG - Intergenic
1067392692 10:45879111-45879133 TAGTCCCAGCTACTCAGGAGAGG + Intergenic
1067548636 10:47216448-47216470 TAATCCCAGCTACTCAGGAGGGG - Intergenic
1067782236 10:49217011-49217033 TAGTCTCAGCTACCCGGTTGGGG - Intergenic
1067811075 10:49427932-49427954 TGGTCCCAGCTACTCTGGAGGGG - Intergenic
1068533231 10:58211791-58211813 TAGTCCCAGCTACTCGGAAGAGG + Intronic
1069010203 10:63363804-63363826 TAGTCCCAGCTACCCGGGAGAGG - Intronic
1069043330 10:63717587-63717609 TAGTCCCAGCTACTTGGGGGCGG - Intergenic
1069061390 10:63898284-63898306 TAGTCCCAGCTACTTGGGAGTGG - Intergenic
1069482807 10:68798863-68798885 TAATCCCAGCTACTTGGGAGAGG + Intergenic
1069738537 10:70672952-70672974 TTGCCCCAGCCACCCGGGCAGGG + Intronic
1070024751 10:72622033-72622055 TAGTCCCAGCTACTCCGGGGAGG - Intronic
1070092609 10:73303014-73303036 TAGTCCGAGCTACCCGGTGGTGG - Intronic
1071469965 10:85977021-85977043 AAGGCCCAGCTTCACGGGAGAGG + Intronic
1071843510 10:89498181-89498203 TAGTCCCAGCTACTCGGAGGTGG + Intronic
1071862282 10:89686474-89686496 TATTCCCAGCTACTGGGGAGTGG - Intergenic
1072127738 10:92462194-92462216 TAGACCTAGCTACTCGGGAGAGG + Intronic
1072398350 10:95068939-95068961 TAGTCCCAGTTACTCGGGGGAGG + Intronic
1072644386 10:97241201-97241223 TAATCCCAGCTACTCGGGGGAGG + Intronic
1072943175 10:99785636-99785658 TAATCCCAGCTACTCGGGAGGGG - Intronic
1073198568 10:101715961-101715983 TAATCCCAGCTGCTCGGGAGGGG - Intergenic
1073231605 10:101975742-101975764 TAGTCCCAGCTACTCGGTTGAGG + Intronic
1073311388 10:102545236-102545258 TAGTCCCAGCTACCCAGGGTGGG - Intronic
1074879420 10:117642394-117642416 TAGTCCCAGCTACTTGGGAGGGG + Intergenic
1075167610 10:120083486-120083508 TAGTCCCAGCTACTTGGGAGGGG - Intergenic
1075501263 10:122977089-122977111 TAACCCCAGCTACTCAGGTGGGG + Intronic
1075841568 10:125509024-125509046 CAGTCCCAGCTACCGGGAAGAGG + Intergenic
1076660637 10:132053915-132053937 TAGTCCCAGCTACTCGGGTGGGG + Intergenic
1076688204 10:132207723-132207745 TGGCCCCAGCTCCCCGTGAGCGG + Exonic
1076906111 10:133361995-133362017 TGGTCCCAGCTACTTGGGAGGGG + Intergenic
1077763789 11:5134992-5135014 TAGTCCCAGCTACTCAGGAGGGG - Intergenic
1078965119 11:16330433-16330455 TAATCCCAGCTACTCAGGAGAGG + Intronic
1078996123 11:16701734-16701756 TAGTCCCAGCTACTCAGGGGCGG + Intronic
1078996938 11:16711402-16711424 TAGTCCCAGCTACTGGGGGGTGG + Intronic
1079026866 11:16955921-16955943 TAGTCCCAGCTACTCAGGAGAGG + Intronic
1079068979 11:17326435-17326457 TAATCCCAGCTACTCGGGAGGGG - Intronic
1079380852 11:19935977-19935999 TAGTCCCAGCTGCTCAGGAGAGG - Intronic
1079386706 11:19986498-19986520 TAATCCCAGCTACTCGGGAGAGG + Intronic
1079460354 11:20672980-20673002 TAATCCCAGCTACTCGGGGGGGG - Intronic
1079593187 11:22206430-22206452 TAGTTCCAGCTACTCAGGAGAGG - Intronic
1080506348 11:32917704-32917726 TAGTCCCAGCTACTTGGGAGAGG + Intronic
1080536810 11:33229904-33229926 TAGTCCCAGCTACTCGGGGGAGG + Intergenic
1080813242 11:35727040-35727062 TAGTCCCAGCTATTCAGGAGAGG + Intronic
1081239249 11:40682653-40682675 TAATCCCAGCTACTTGGGAGAGG + Intronic
1081589439 11:44410939-44410961 TAAGCCCAGCTGCCCTGGAGCGG + Intergenic
1081639155 11:44740895-44740917 TAGTCCCAGCTACTTGGGACAGG - Intronic
1082101927 11:48179848-48179870 TGGTCCCAGGTACCCAGGAGAGG - Intergenic
1083029586 11:59579829-59579851 TAATCCCAGCTACTCGGGTGAGG - Intronic
1083041521 11:59691962-59691984 TAGCCCCAGCTACTCAGGATGGG - Intergenic
1083635465 11:64118320-64118342 CAGCCCCAGCTGCCCTGGCGTGG + Exonic
1084079299 11:66809823-66809845 TAGTCCCAGCTACTCAGGAGAGG - Intronic
1084867678 11:72072920-72072942 TAGTCCCAGCTACTCGGGAGGGG + Intronic
1084964539 11:72737742-72737764 TAGTCCCAGCTACTCTGGAGAGG - Intronic
1085579948 11:77641517-77641539 TAATCCCAGCTACTCAGGAGGGG - Intergenic
1085635997 11:78160028-78160050 TGGTCCCAGCTACACGGGTGAGG - Intergenic
1085636051 11:78160329-78160351 TGGTCCCAGCTACACGGGTGAGG - Intergenic
1086467526 11:87070512-87070534 TAATCCCAGCTACTCGGGAGGGG + Intronic
1087148328 11:94834465-94834487 TAGTCCCAGCTACTCGGGGTGGG + Intronic
1087838755 11:102901028-102901050 TAGTCCCAGCTACCCAGGCCTGG - Intergenic
1088896035 11:114078990-114079012 TAATCCCAGCTAGTCGGGAGAGG + Intronic
1089018559 11:115187558-115187580 TAGTCCCAGCTACTTGGGGGCGG - Intronic
1089568063 11:119382848-119382870 TAATCCCAGCTACTCGGGGGAGG - Intergenic
1090283658 11:125480254-125480276 TAGTCCCAGCTACTCGGGGAGGG + Intronic
1090784363 11:130036227-130036249 TAGTCCCAGCTATCAGGGGGTGG + Intergenic
1091121929 11:133064409-133064431 TTGCCACAGCTACCAGGGAAAGG - Intronic
1091661336 12:2385895-2385917 CAGCCCCAGCGACTCAGGAGAGG + Intronic
1092174968 12:6397743-6397765 TAGTCCCAGCTACTGGAGAGAGG - Intergenic
1092346984 12:7723503-7723525 TAATCCCAGCTACTCGGGAGTGG + Intergenic
1093468148 12:19471643-19471665 TAGTCCCAGCTACTCAGGGGTGG - Intronic
1093587274 12:20854665-20854687 TAGCCCTGGCTAACTGGGAGGGG - Intronic
1094015386 12:25857207-25857229 TAGTCCCAGCTACTCAGGAGAGG + Intergenic
1094467171 12:30765716-30765738 TAGCCCAAGCTACCCAGCATGGG - Intergenic
1094550545 12:31446773-31446795 TAGTCCCAGCTACTCGGGGCAGG + Intronic
1094684136 12:32694203-32694225 TAGTCCCAGCTACTCAGGATAGG - Intronic
1095542016 12:43321182-43321204 TAGTCCCAGCTACTCATGAGTGG - Intergenic
1095699386 12:45175243-45175265 TAGTCCCAGCTACTCTGGGGAGG + Intergenic
1095795570 12:46215525-46215547 TAATCCCAGCTACTCAGGAGAGG - Intronic
1095892118 12:47244614-47244636 GAGCCCCAACTAACTGGGAGGGG - Intergenic
1095937145 12:47697174-47697196 TAGCCTTTGATACCCGGGAGTGG + Intronic
1096141955 12:49249739-49249761 TAGTCCCAGTTACTCGGGTGGGG + Intronic
1096192409 12:49628680-49628702 TAGTCCCAGCTACTCGGGAGAGG - Intronic
1096440620 12:51640021-51640043 TAGTCCCAGCTACCCAGCTGAGG - Intronic
1098060964 12:66561973-66561995 TAGTCCCAGCTACCTGGTGGGGG + Intronic
1098321525 12:69249138-69249160 TAGTCCCAGCTACTCGGGGGGGG + Intronic
1099224330 12:79950902-79950924 TAGTCCCAGCTACTTGGTAGGGG - Intergenic
1100554025 12:95674027-95674049 TAGTCCCAGCTACCCGTGGAGGG + Intronic
1100578206 12:95912939-95912961 TAGTCCCAGCTACTTGGGAGGGG + Intronic
1101717493 12:107323228-107323250 TAGTCCCAGCTACTCGGCTGAGG - Intronic
1102065893 12:109975323-109975345 TAGTCTCAGCTACTCAGGAGGGG - Intronic
1102178660 12:110895031-110895053 TAATCCCAGCTACTCGGGGGCGG - Intronic
1102360279 12:112280908-112280930 TAGTCTCAGCTACTCGGGAGGGG - Intronic
1102469944 12:113154157-113154179 TAGTCCCAGCTACTTTGGAGCGG + Intronic
1102896958 12:116605944-116605966 TAATCCCAGCTACTCGGGGGAGG - Intergenic
1103416863 12:120748100-120748122 TAGTCCCAGCTACTCGGGGCCGG + Intergenic
1103633945 12:122286876-122286898 TAATCCCAGCTACTCAGGAGGGG + Intronic
1103843923 12:123888090-123888112 TAGTTCCAGCTACTCAGGAGGGG + Intronic
1104249861 12:127081984-127082006 TAATCCCAGCTCCTCGGGAGGGG - Intergenic
1104504824 12:129321676-129321698 TAGTCCCAGCTAGTCGGGGGAGG - Intronic
1104658988 12:130595436-130595458 TAGTCCCAGCTACTCAGGACAGG + Intronic
1105682778 13:22746275-22746297 TAGTCCCAGCTACTCGGGGAGGG - Intergenic
1105725109 13:23155571-23155593 TAGTCCCAGCTACTCGGCTGAGG + Intergenic
1106490537 13:30217332-30217354 TAATCCCAGCTACTCGGGAGGGG + Intronic
1106534211 13:30624496-30624518 TAGCCCCAGCTACCCGGGAGGGG + Intronic
1106855473 13:33847019-33847041 TAATCCCAGCTACTCGGGAGAGG - Intronic
1107161857 13:37239550-37239572 TAATCCCAGCTACTTGGGAGGGG + Intergenic
1107585401 13:41841664-41841686 TAGTCCCAGCTACTCGGGAGGGG + Intronic
1108349992 13:49583055-49583077 TGGTCCCAGCTACTTGGGAGTGG + Intronic
1109708400 13:66130260-66130282 TAGTCCCAGCTACTCGGGAATGG - Intergenic
1110549617 13:76797860-76797882 TAGTCCCAGCTACTGGGGACAGG - Intergenic
1111693619 13:91595135-91595157 TAGTCCCAGCTACTCGGGAGGGG - Intronic
1112652155 13:101411465-101411487 TAATCTCAGCTACTCGGGAGGGG - Intronic
1113143551 13:107182392-107182414 TAGGCCCAGCTACTTGAGAGAGG - Intronic
1114269852 14:21093975-21093997 TAGCCCAACCTACATGGGAGAGG - Intronic
1115297894 14:31850743-31850765 TGGTCCTAGCTACTCGGGAGGGG - Intronic
1115621309 14:35143279-35143301 TAATCCCAGCTACTCGGGGGAGG - Intronic
1115635810 14:35289449-35289471 TAATCCCAGCTACTCGGGAGAGG - Intronic
1116399141 14:44483831-44483853 TAATCCCAGCTACTTGGGAGGGG + Intergenic
1116916010 14:50526413-50526435 TAATCCCAGCTACTTGGGAGAGG - Intronic
1116993179 14:51296975-51296997 TAGACCCAGCAACAAGGGAGAGG + Intergenic
1117363650 14:55003389-55003411 TAGTCCCAGCTACTCGGGTTGGG + Intronic
1117703085 14:58434906-58434928 TAGTCCCAGCTACTCTGGCGGGG - Intronic
1117962124 14:61173757-61173779 TAGTCCCAGCTATCGGGAAGCGG - Intergenic
1118307194 14:64664798-64664820 TAGTCCCAGCTACTCGGCTGAGG - Intergenic
1118348395 14:64956282-64956304 TAATCCCAGCTACTCAGGAGCGG + Intronic
1118578333 14:67267376-67267398 TAATCCCAGCTACTTGGGAGGGG - Intronic
1118675878 14:68183970-68183992 TAGTCCCAGCTACTCGGGGGGGG + Intronic
1119532637 14:75373750-75373772 TAGCCCCAGCTACCCAGACCTGG + Intergenic
1119776130 14:77249952-77249974 TAGTCCCAGCTACTGGGGAGGGG - Intronic
1120850163 14:89162701-89162723 GAGCCCCAGCGACACGGAAGAGG - Exonic
1121894037 14:97628727-97628749 TAGTCCCAGCTACATGGGAGGGG - Intergenic
1122458054 14:101871361-101871383 TAGTCCCAGCTACTTGGGGGAGG - Intronic
1122663746 14:103315035-103315057 TGGTCCCAGCTACTCGGGAGGGG + Intergenic
1122730885 14:103796836-103796858 TAGCCCCAGCTACTGGGAGGCGG + Intronic
1122803882 14:104247113-104247135 TGGCCCCAGCTCCTCTGGAGGGG - Intergenic
1122895893 14:104756797-104756819 TAGCCCCAGCAAGCCGTGATGGG + Intronic
1123013361 14:105360422-105360444 TAATCCCAGCTACTAGGGAGGGG + Intronic
1202841782 14_GL000009v2_random:127555-127577 TAGTCCCAGCTACTCGGCTGAGG + Intergenic
1123505284 15:20936249-20936271 TAGTCCCAGTTACTCAGGAGAGG + Intergenic
1123562523 15:21509952-21509974 TAGTCCCAGTTACTCAGGAGAGG + Intergenic
1123598768 15:21947229-21947251 TAGTCCCAGTTACTCAGGAGAGG + Intergenic
1123828318 15:24106374-24106396 TAGTCCCAGCTACTTGGGAGGGG - Intergenic
1123842622 15:24264326-24264348 TAGTCCCAGCTACTAGAGAGGGG - Intergenic
1123857661 15:24430374-24430396 TAGTCCCAGCTACTTGGGAGGGG - Intergenic
1123862295 15:24480908-24480930 TAGTCCCAGCCACTTGGGAGGGG - Intergenic
1125581450 15:40788753-40788775 TAGTCCCAGCTACTTGGGTGGGG + Intronic
1125731974 15:41897601-41897623 TCTCCCCAGCTCCCAGGGAGGGG - Exonic
1125965869 15:43875076-43875098 TAATCCCAGCTACTCAGGAGGGG + Intronic
1126138818 15:45419340-45419362 TAGTCCCAGCTACTTGGGAGGGG + Intronic
1126594831 15:50374894-50374916 TAGTCCCAGCTACTCGGCTGAGG + Intergenic
1127144750 15:56012828-56012850 TAGTCCCAGCTACTCAGGTGAGG + Intergenic
1127480469 15:59372536-59372558 CAGCCCCAGTTCCCCGGCAGCGG - Exonic
1127753027 15:62064757-62064779 TAGTCCCAGCTACTCAGGAGGGG + Intergenic
1127801659 15:62482480-62482502 TAATCCCAGCTACTCAGGAGGGG + Intronic
1128086942 15:64893238-64893260 TAATCCCAGCTACTCGGGATTGG - Intronic
1128425801 15:67541708-67541730 TAGTCCCAGTTACTCGGCAGGGG + Intergenic
1128880179 15:71235706-71235728 TGGTCCCAGCTACTCGGGAGAGG - Intronic
1130002951 15:80063668-80063690 TAGTCCCAGCTACTGGGGAGAGG - Intronic
1130261647 15:82359092-82359114 TAGTCCCAGCTACTCGGGAGAGG - Intergenic
1130279588 15:82509920-82509942 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
1130470967 15:84226103-84226125 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
1130478461 15:84340673-84340695 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
1130493309 15:84447459-84447481 TAGTCCCAGCTACTCGGGAGAGG - Intergenic
1130593256 15:85230741-85230763 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
1131015315 15:89053084-89053106 TAGTCCCAGCTACTCGGGGGTGG - Intergenic
1131062355 15:89411694-89411716 TGGCGCCAGGGACCCGGGAGAGG - Intergenic
1131226743 15:90630493-90630515 TAGTCCCAGCTACTCCAGAGCGG + Intronic
1132355851 15:101170708-101170730 GAGCGCCAGCTTCCTGGGAGTGG + Intergenic
1202970874 15_KI270727v1_random:237091-237113 TAGTCCCAGTTACTCAGGAGAGG + Intergenic
1132502892 16:292490-292512 TAGCCACAGCCTCCCTGGAGTGG + Intronic
1132767714 16:1542854-1542876 TAGACCCAGCAACCTGGGACAGG + Intronic
1132780880 16:1624698-1624720 TAGTCCCAGCTACTCGGGAGGGG - Intronic
1133238408 16:4400511-4400533 TAATCCCAGCTACTCGGGACGGG + Intronic
1133276832 16:4643489-4643511 TAGTCCCAGGTACTTGGGAGGGG - Intronic
1133344572 16:5061309-5061331 TAGTCCCAGCTACTTGAGAGAGG + Intronic
1134028212 16:10970866-10970888 TAGTACCAGCTACTTGGGAGAGG - Intronic
1134134729 16:11670865-11670887 CTGCCCCAGCTACCAGAGAGGGG - Intronic
1134508933 16:14830767-14830789 TAGTCCCAGATACTCCGGAGAGG - Intronic
1134584558 16:15398711-15398733 TAATCCCAGCTACTCAGGAGGGG - Intronic
1134605379 16:15567045-15567067 TAGTCCCAGCTACTCCGTAGGGG + Intronic
1134696634 16:16229601-16229623 TAGTCCCAGATACTCCGGAGAGG - Intergenic
1134738899 16:16524925-16524947 TAGTCCCAGGTACTCGGGGGAGG - Intergenic
1134905577 16:17977036-17977058 TAGTCCCAGCTACTCGGCTGAGG - Intergenic
1134928600 16:18187228-18187250 TAGTCCCAGGTACTCGGGGGAGG + Intergenic
1135137495 16:19895727-19895749 TGGTCCCAGCTACTCAGGAGGGG + Intergenic
1135463788 16:22667942-22667964 TAGTACCAGCTACTCAGGAGAGG - Intergenic
1135494343 16:22938462-22938484 TAGTCTCAGCTACTCAGGAGGGG - Intergenic
1136119499 16:28122491-28122513 TAGTCTCAGCTACTTGGGAGAGG + Intronic
1136133494 16:28239870-28239892 TAGCCCCAGATGCCCTTGAGGGG + Intergenic
1136410317 16:30072912-30072934 TAATCCCAGCTACTCTGGAGAGG - Intergenic
1136526819 16:30836346-30836368 TAGTCCCAGCTACTGGGGTGGGG + Intronic
1136568264 16:31082564-31082586 AAGCCGCAGCTGCCAGGGAGTGG + Intronic
1136638107 16:31538613-31538635 TAGTCCCACCTACTCTGGAGGGG + Intergenic
1137283412 16:46997075-46997097 TAGTCCCAGCTACTTGGGAGGGG + Intergenic
1137990667 16:53151371-53151393 TAATCCCAGCTACTTGGGAGAGG - Intronic
1138036594 16:53613436-53613458 TAGTCCCAGCTACCAGGGGGAGG - Intronic
1138038268 16:53630850-53630872 TAATTCCAGCTACTCGGGAGGGG - Intronic
1138449752 16:57086659-57086681 TAGTCCCAGCTACTCGGGGCGGG + Intergenic
1138475385 16:57267757-57267779 TAATCCCAGCTACTTGGGAGAGG + Intronic
1139453806 16:67054872-67054894 TAGTCCCAGCTACGCGTGGGAGG - Intronic
1139555782 16:67709181-67709203 TAGTCCCAGCTACTCAGGAGAGG + Intronic
1139582931 16:67883947-67883969 CATCCCCAGCTACCTGGAAGAGG + Exonic
1139648423 16:68348756-68348778 CAGTCCCAGCTACTCGGGAGAGG - Intronic
1139792580 16:69451829-69451851 TAGTCCCAGCTACTCGGGGCAGG + Intronic
1139819259 16:69707558-69707580 TAGTCCCAGCTACTCGGGGTAGG - Intronic
1139893913 16:70272799-70272821 TAGTCCCAGCTACTCGGGAGAGG + Intronic
1139903216 16:70344529-70344551 TAATCCCAGCTACTCGGGAGAGG - Intronic
1140108801 16:71985549-71985571 TAGTCCCAGCTACTTGGGGGTGG - Intronic
1140168524 16:72579642-72579664 TAGTCCCAGCTACTTGGAAGTGG - Intergenic
1140721709 16:77778017-77778039 CAGTCCCAGCTACTCAGGAGGGG - Intergenic
1142537324 17:627654-627676 TAATCCCAGCTACTTGGGAGGGG + Intronic
1142872946 17:2832854-2832876 TAGTCCCAGCTACTCGGTGGGGG + Intronic
1143113382 17:4566586-4566608 TAATCCCAGCTACTTGGGAGAGG - Intergenic
1143503199 17:7350728-7350750 TAGTCCCAGCTACTCAGGGGAGG - Intronic
1143560725 17:7692871-7692893 TAGTCCCAGCTACTCGGGAGAGG - Intronic
1143576882 17:7798936-7798958 TAGTTCCAGCTACTCGGGGGTGG + Intronic
1143675245 17:8427580-8427602 TAGTTCCAGCTACTCGGGGGCGG + Intronic
1143813821 17:9494501-9494523 TAGTCCCAGCTACTCGGAGGTGG + Intronic
1143869807 17:9949981-9950003 TAATCCCAGCTACCCGGGAGAGG - Intronic
1143955653 17:10666452-10666474 CAGTCCCAGCTACTTGGGAGTGG + Intergenic
1144559207 17:16307849-16307871 TAGTCTCAGCTACTTGGGAGAGG + Intronic
1144559356 17:16308904-16308926 TAGTCTCAGCTACTTGGGAGAGG - Intronic
1145214164 17:21040068-21040090 TAGTCCCAGCTACTCAGGAGAGG + Intronic
1145952896 17:28833495-28833517 TAGTCCCAGCTACTTGGGAGAGG + Intronic
1146100737 17:29979228-29979250 TAGTCCCAGCTACTCGAGAGTGG + Intronic
1146181582 17:30701838-30701860 TAGTCCCAGCTACTCAGGATCGG - Intergenic
1146262254 17:31429705-31429727 TAATCCCAGCTACTCAGGAGAGG + Intronic
1147302183 17:39538606-39538628 AAACCCCGGCTACCTGGGAGCGG + Intronic
1147335765 17:39726212-39726234 TAGTCCCAGCTACTCAGGAGAGG + Intronic
1147603797 17:41762513-41762535 TGGTCCCAGCTACTGGGGAGGGG - Intronic
1147677089 17:42214869-42214891 TAGTCCCAGCTACTTGGGGGGGG - Intronic
1147751644 17:42738879-42738901 TAGTCCCAGCTACTCAGGGGGGG - Intronic
1148037331 17:44676700-44676722 TAGTCTCAGCTACTTGGGAGGGG + Intronic
1148085426 17:44990944-44990966 TAGTCCCAGCTACTCGGGAGTGG + Intergenic
1148412517 17:47480203-47480225 TAATCTCAGCTACTCGGGAGGGG - Intergenic
1149458200 17:56806643-56806665 TAGTTCCAGCTACTCAGGAGAGG - Intronic
1149658884 17:58324384-58324406 TGGCCCCAGCTACCCGGGGGCGG - Intronic
1149755785 17:59184341-59184363 TAATCCCAGCTACTCAGGAGCGG + Intronic
1150777269 17:68091354-68091376 TATTCCCAGCTACTCGGGAGAGG + Intergenic
1150875749 17:68968619-68968641 TAGTCCCAGCTACTCGGGGGGGG - Intergenic
1150965850 17:69967549-69967571 TAATCCCAGCTACCTGGGAGAGG + Intergenic
1151360914 17:73588265-73588287 TAATCTCAGCTACTCGGGAGGGG + Intronic
1152406108 17:80098817-80098839 TAATCTCAGCTACCCGGGCGTGG + Intronic
1153538754 18:6132968-6132990 TAGCACCAGTTCCACGGGAGGGG + Intronic
1153754921 18:8272091-8272113 TAATCCCAGCTACTCGGGAGAGG + Intronic
1153862183 18:9223373-9223395 TAGTCCCAGCTACTCGGGGGAGG - Intronic
1154283998 18:13034694-13034716 TAGTCCCAGCTACTCAGGAGGGG + Intronic
1154369826 18:13749877-13749899 TAGTCCCAGCTACTCAGAAGGGG - Intronic
1154938609 18:21088374-21088396 TGGTCCCAGCTACTCAGGAGAGG + Intronic
1155152279 18:23132841-23132863 TAGTCCCAGCTACTCGGGGGGGG + Intergenic
1155229480 18:23758556-23758578 TAGCCTCAGCCCCCAGGGAGAGG - Intronic
1155436549 18:25818486-25818508 CAGTCCCAGCTACTCAGGAGGGG - Intergenic
1155644525 18:28061523-28061545 TAACCTCAGCTACTTGGGAGTGG + Intronic
1156203827 18:34864371-34864393 TAGTCCCAGCTACTCGGCGGGGG - Intronic
1156304631 18:35865876-35865898 TAGACCCAGCTACTTGGGTGGGG - Intergenic
1158465115 18:57682945-57682967 TAGTCCCAGCTACTCAGGTGGGG - Intronic
1158708023 18:59811504-59811526 TAGTCCCAGCTACTCAGGAGAGG - Intergenic
1158966607 18:62627672-62627694 TGGTCCCAGCTACTCAGGAGGGG - Intergenic
1158994469 18:62903642-62903664 TAGTCCCAGCTACTTGGGAATGG + Intronic
1160691921 19:464155-464177 CAGCCCCAGCTACACGGTGGTGG - Exonic
1160734322 19:655184-655206 TAGCTCCAGCTACTAAGGAGGGG + Intronic
1161077680 19:2294310-2294332 GAGCCCCAGGAAGCCGGGAGAGG + Intronic
1161159358 19:2753247-2753269 TAGACCCAGCAACCCTGGGGTGG + Intergenic
1161328461 19:3674622-3674644 TAGTCCCAGCTACTCGGGGGAGG - Intronic
1161564246 19:4990999-4991021 TAGTCCCAGCTACTAGGGAGGGG + Intronic
1161658202 19:5529102-5529124 TAGTCCCAGCTACTCGGGGGAGG - Intergenic
1161724013 19:5918147-5918169 TATTCCCAGCCACCTGGGAGTGG - Intronic
1161781538 19:6296341-6296363 TAGTCCCACCTACTCGGGAGAGG - Intergenic
1162056094 19:8065096-8065118 TGGTCCCAGCTACTTGGGAGAGG + Intronic
1162158025 19:8693115-8693137 TAGTCCCAGCTACTTGGCAGAGG - Intergenic
1162243015 19:9372663-9372685 TAATCCCAGCTACTCGGGAGGGG - Intronic
1162411921 19:10511347-10511369 TAGCCCCAGCTACTCGGGTTGGG + Intergenic
1162663641 19:12191794-12191816 TAATCCCAGCTACTTGGGAGTGG + Intergenic
1162708404 19:12573168-12573190 TAATCCCAGCTACTCGGGGGCGG + Intronic
1162767930 19:12931209-12931231 TAGTCCCAGCTACTCGGGACTGG - Intronic
1162771250 19:12950519-12950541 TAGTCCCAGCTACTCGGGCGGGG - Intronic
1162963608 19:14144319-14144341 TAGTCCCAGGTACTCGGGACTGG - Intergenic
1163740284 19:19007572-19007594 TAATCCCAGCTACTCGGGGGAGG - Intronic
1164243311 19:23409128-23409150 TAGTCCCAGCTACTGGGAAGTGG + Intergenic
1164520033 19:28972168-28972190 GAGCACCAGCTACCGTGGAGGGG + Intergenic
1164706978 19:30326985-30327007 TAGTCCCAGCTACTCAGGCGCGG + Intronic
1164899213 19:31904046-31904068 TAACACCAGCTTCCCTGGAGAGG + Intergenic
1164979306 19:32601477-32601499 TAGTCCCAGCTACTTGAGAGTGG + Intronic
1164989172 19:32672475-32672497 AAGCCCCAGCTCCCAGGGAGAGG + Intronic
1165221570 19:34320840-34320862 TAGTCCCAGCTACTTGGAAGAGG - Intronic
1165357265 19:35311933-35311955 GAGCCCCAGCTTCTCGGCAGGGG + Exonic
1165388410 19:35525004-35525026 CAGCCCCAGTCACCCTGGAGGGG - Intronic
1165485285 19:36091767-36091789 TAGTCCCAGCTACTCAGGAGGGG + Intronic
1165973821 19:39657140-39657162 TTGCCCCAGCTACACAAGAGGGG + Intronic
1166090459 19:40505269-40505291 TAGTCCCAGCTACTCTGAAGTGG + Intronic
1166124750 19:40707571-40707593 TAACCCCAGCTACTTGGGTGGGG - Intronic
1166227051 19:41402758-41402780 TAGTCCCAGCTACTCGAGAGGGG - Intronic
1167064943 19:47178119-47178141 TAGTCCCAGCTACTCGGGAGGGG + Intronic
1167065356 19:47181596-47181618 TAGTCCCAGCTACCTGGGAGGGG - Intronic
1167585830 19:50375235-50375257 TAATCCCAGCTACTCGGGAGAGG - Intronic
1167610680 19:50506497-50506519 CAGCCCCAGCGACACGGGCGAGG + Exonic
1168173704 19:54607959-54607981 CAGCCCCAGCTGCCCGGGGGTGG - Intronic
1168199500 19:54804668-54804690 TAGCCCCAGGCACCCAGGTGTGG + Intronic
1168318077 19:55492905-55492927 TAGTCCCAGCTACTTGGGAGAGG + Intronic
1202708197 1_KI270713v1_random:39992-40014 TAGTCCCAGCTACTCCGGAGGGG - Intergenic
925925191 2:8665115-8665137 TAGTCCCAGCTACTCGGGTGGGG + Intergenic
926224774 2:10959724-10959746 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
926356668 2:12047056-12047078 TAGTCCCAGCTACTCGGGGGAGG - Intergenic
926901149 2:17753529-17753551 GACCCCCAGCCACCCGGGAGAGG - Intronic
928510165 2:31995330-31995352 TAATCCCAGCTACTCGGGAGAGG + Intronic
928516018 2:32045599-32045621 TAGTCCCAGCTACTCAGGGGCGG + Intergenic
928546628 2:32334928-32334950 TAGTCCCAGCTACTCGGGGGCGG + Intergenic
928842940 2:35632805-35632827 TAGTCCCAGCTACTTGGGAGGGG - Intergenic
928979155 2:37120383-37120405 TAGTCCCAGCTACTCCGGGGAGG + Intronic
929202626 2:39253251-39253273 TAGTCCCAGCTACTCGGGAGAGG - Intronic
929250711 2:39751802-39751824 TAGTCCCACCTACTTGGGAGGGG - Intronic
929278733 2:40054620-40054642 TAATCCCAGCTACTCGGGAGTGG + Intergenic
929299787 2:40289739-40289761 TAATCCCAGCTACTCAGGAGGGG + Intronic
929705761 2:44210336-44210358 TAGTTCCAGCTACTTGGGAGAGG - Intronic
929857541 2:45650026-45650048 AATCCCCAGCTCCCCGGCAGCGG + Intergenic
929962726 2:46508554-46508576 TAGTCCCAGCTACTCAGGACTGG + Intronic
930797050 2:55404849-55404871 TAACCCCAGCTACTCGGGGGAGG - Intronic
931267836 2:60676192-60676214 TAGTCCCAGTTACTCGGGGGGGG - Intergenic
931351660 2:61495787-61495809 TGGTTCCAGCTACTCGGGAGGGG - Intronic
932020028 2:68075065-68075087 TAGTCCCAGCTACTTGGGCGGGG + Intronic
932250653 2:70240750-70240772 TAATCCCAGCTACCTGGGAAGGG + Intronic
932723176 2:74154069-74154091 TAGTTCCAGCTACTCAGGAGAGG + Exonic
932932657 2:76061022-76061044 TAATCCCAGCTACTTGGGAGAGG - Intergenic
932965623 2:76471697-76471719 TAGTCCCAGCTACTCAGTAGGGG + Intergenic
934869342 2:97847057-97847079 TAGTCCCAGCTACTGGGGGGGGG + Intronic
934885973 2:98025301-98025323 TAGTCCCAGCTTCCCTGGGGTGG - Intergenic
935760070 2:106312342-106312364 TAGTCCCAGCTACTTGGGAGGGG - Intergenic
936444018 2:112581913-112581935 GACCCCCAGCAACCCTGGAGTGG - Intergenic
936450557 2:112630835-112630857 TAATCCCAGCTACTCGGGAGAGG + Intergenic
937156357 2:119722259-119722281 TAGTCCCAGTTACCTAGGAGGGG + Intergenic
937396042 2:121535776-121535798 TAGTCCCAGCTACTGGGGAGGGG - Intronic
938419240 2:131130903-131130925 TAGTCCCAGCTACTGGGAAGGGG - Intronic
938589502 2:132722933-132722955 TGGTTCCAGCTACTCGGGAGAGG - Intronic
938769047 2:134484018-134484040 TAATCCCAGCTACTCGGGAGAGG + Intronic
939067647 2:137503903-137503925 TAGTCCCAGCTACCTGGGGGAGG + Intronic
940214537 2:151290694-151290716 TAATCCCAGCTACTTGGGAGTGG - Intergenic
940300752 2:152174719-152174741 TAGTCCCAGCTACTCGGGAAGGG + Intronic
940882880 2:158964462-158964484 TGGCCCCAGGTAACAGGGAGAGG + Intergenic
941785950 2:169498683-169498705 TAGTCCCAGCTACTCCGGAGAGG + Intronic
941786914 2:169506922-169506944 TAGTCCCAGCTACCTGGGAGGGG + Intronic
941915303 2:170808965-170808987 TAGTCCCAGCTACTCAGGGGTGG + Intergenic
942238649 2:173938335-173938357 TAATCCCAGCTACTCGGGAGAGG + Intronic
942357413 2:175132964-175132986 TAGTCCCAGCTACTTGAGAGAGG + Intronic
943147973 2:184069658-184069680 TAGTCCCAGCTACTCGGGGGAGG + Intergenic
943597839 2:189879239-189879261 TAATCCCAGCTACTCGGGGGAGG - Intergenic
943926583 2:193791437-193791459 TAGCCCCATTTACCGGGCAGCGG + Intergenic
944345425 2:198659689-198659711 TAGCCCCACCTACCAGAGAAGGG - Intergenic
944503120 2:200382192-200382214 TAGTCCCAGGTACTGGGGAGGGG - Intronic
944687735 2:202132545-202132567 TAATCCCAGCTACGCGGGAGGGG + Intronic
946376984 2:219316656-219316678 TAGTCTCAGCTACTCGGGAGAGG - Intergenic
946785122 2:223235311-223235333 TAGTCCCAGCTACTCGGGGTGGG + Intergenic
946870863 2:224083487-224083509 TAATCCCAGCTACTCGGGGGCGG + Intergenic
947173326 2:227335049-227335071 TAATCCCAGCTACTCTGGAGGGG + Intronic
1170862631 20:20122273-20122295 TAGTCCCAGCTGCTCGGGAGAGG - Intronic
1170864449 20:20141036-20141058 TAATCCCAGCTACTCAGGAGAGG - Intronic
1172335157 20:34109977-34109999 TAATCCCAGCTACTCAGGAGAGG + Intronic
1172365046 20:34342745-34342767 TAGTCCCAGCTACTCAGGGGTGG - Intergenic
1172454080 20:35052609-35052631 TAGTCCCAGCTACTCAGGAGAGG - Intronic
1172575455 20:36004680-36004702 TAGTCCCAGCTACTCAGGAGAGG - Intronic
1172687810 20:36770184-36770206 TAGTCCCAGCTACTGGAGAGAGG - Intronic
1173658510 20:44717327-44717349 TAGGCCCCGATACCCAGGAGAGG - Intronic
1173723706 20:45282010-45282032 TAGTCCCAGCTACTCGGGTAAGG + Intergenic
1173973722 20:47171971-47171993 TAATCCCAGCTACTTGGGAGGGG + Intronic
1174018134 20:47505922-47505944 TAGTCCCAGCTACTCGGGCAGGG - Intronic
1174333088 20:49836447-49836469 CAGTCCCAGCTACTTGGGAGAGG - Intronic
1174379147 20:50145573-50145595 TAGTCCCAGCTACTCGGGAGAGG + Intronic
1174689010 20:52484159-52484181 TAGTCACAGCTACTCTGGAGAGG + Intergenic
1175030368 20:55947443-55947465 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
1175294303 20:57897781-57897803 CAGCCCGAGCTTCCCGGGACAGG - Intergenic
1175332630 20:58175816-58175838 CAGCTCCATCTACCCAGGAGAGG + Intergenic
1175441737 20:58997035-58997057 TAGTCCCAGCTACTCGGTGGAGG + Intronic
1176630521 21:9132484-9132506 TAGTCCCAGCTACTCGGCTGAGG + Intergenic
1177457155 21:21355313-21355335 TAGTTCCAGCTACTCGGGACGGG + Intronic
1177957390 21:27616301-27616323 TAGTCCCAGCTACTCGGAAGGGG - Intergenic
1179021524 21:37645238-37645260 TGGTCCCAGCTACTCAGGAGGGG + Intronic
1179127843 21:38607510-38607532 TAGTCCCAGCTACTCCTGAGAGG + Intronic
1179470095 21:41604728-41604750 TTGCCCTAGCTCCCAGGGAGGGG - Intergenic
1180081778 21:45490518-45490540 GAGGCCCAGAGACCCGGGAGTGG - Intronic
1181110715 22:20601301-20601323 TAATCCCAGCTACTCGGGAGAGG - Intergenic
1181140578 22:20801762-20801784 TAATCCCAGCTACTCGGGGGAGG + Intronic
1181257749 22:21574843-21574865 TAATCCCAGCTACTAGGGAGGGG + Intronic
1181380816 22:22501985-22502007 TAGTCCCAGCTACTCAGGGGTGG + Intronic
1181541883 22:23578001-23578023 TAGTCCCAGCTACTCGGGAGGGG - Intronic
1181578391 22:23810908-23810930 TAATCCCAGCTACTCGGGAACGG + Intronic
1183307849 22:37092457-37092479 TAGTCCTAGCTACTCGGGGGTGG - Intronic
1183438943 22:37812215-37812237 TAGTCCCAGCTACTAGGGAGGGG + Intronic
1183503718 22:38196686-38196708 TAGTCCCAGCTACTTGGGGGAGG + Intronic
1183924853 22:41198344-41198366 TAGTCCCAGCTACTGGGGCGGGG + Intergenic
1183959172 22:41400879-41400901 TAGTCCCAGCTACTTGGGGGAGG - Intergenic
1184595205 22:45509690-45509712 TAATCCCAGCTACTCAGGAGGGG + Intronic
1184693492 22:46127860-46127882 TAGCCCCAGCCTGTCGGGAGAGG - Intergenic
1184755541 22:46513912-46513934 TAGTCCCAGCTACTCGGGGGGGG - Intronic
1185318266 22:50188362-50188384 CAGCCCCAGCTACTCAGGAGAGG - Intronic
949553307 3:5130653-5130675 TAATCCCAGCTACTGGGGAGAGG - Intronic
950294695 3:11818776-11818798 TAGTCCCAGCTACTTGGGGGGGG + Intronic
951206412 3:19930720-19930742 TAGTCCTAGCTACTTGGGAGAGG - Intronic
951920052 3:27844431-27844453 TTGCCCCAGCTACCTTGCAGAGG + Intergenic
952181041 3:30916955-30916977 TAGTCCCAGTTACTCGGAAGGGG + Intergenic
952259907 3:31729810-31729832 TAGTCCCACCTACCTGGGTGCGG - Intronic
952863085 3:37831129-37831151 TAGTCCCAGCTACAGGGGTGTGG + Intergenic
953024308 3:39135933-39135955 TAGTCCCAGCTACTCGGGGGTGG + Intronic
953226107 3:41022862-41022884 TAGTTCCAGCTACTCGGGACCGG - Intergenic
953284527 3:41593911-41593933 TAGTCCCAGCTACCGGGGTTGGG + Intronic
953528208 3:43713196-43713218 TAATCCCAGCTACTCAGGAGAGG + Intronic
953658751 3:44874767-44874789 TGGCCCCAGGCACCCGGCAGAGG - Intronic
954316793 3:49805842-49805864 TAGCCCCAGCCTCCAGGGACTGG + Intronic
954562940 3:51573589-51573611 TAGTCCCACCTACTCGGGCGTGG - Intronic
954721616 3:52569010-52569032 TAGTCCCAGCTACCCGGAGTAGG - Intronic
954768307 3:52941776-52941798 TAGACCCAGCTACTTGGCAGGGG + Intronic
956440656 3:69277649-69277671 TAGTCCCAGCTACTCGGGACGGG - Intronic
957006403 3:74952991-74953013 TAGTCCCAGCTACTCGGAAGCGG + Intergenic
958490798 3:94769531-94769553 TAGTCCCAGCTACTCGGGGCAGG + Intergenic
959079963 3:101789808-101789830 TAGTCCCAGTTACTTGGGAGGGG - Intronic
959663684 3:108897697-108897719 TAGTCCCAGCTACTCGGGAGGGG - Intergenic
959702882 3:109314944-109314966 TAATCCCACCTACTCGGGAGGGG + Intronic
960867530 3:122217216-122217238 TAGTCCCAGCTACTCAGGAGTGG - Intronic
961249656 3:125490400-125490422 TAGTCCCAGCTACTCCGGAGAGG + Intronic
961740639 3:129031309-129031331 TAGTCCCAGCTACTCGGAGGGGG + Intronic
961746251 3:129065184-129065206 TGGTCCCAGCTATTCGGGAGAGG - Intergenic
962337168 3:134545117-134545139 TAATCCCAGCTACTCGGGATCGG - Intronic
962542125 3:136393383-136393405 TAATCCCAGCTACTCAGGAGAGG + Intronic
963017020 3:140834283-140834305 TAGCCCCAGCTACTCAGCTGAGG - Intergenic
963326489 3:143868994-143869016 TAGTCCCAGCTACTTGGGGGAGG - Intergenic
964099600 3:152972871-152972893 TAGTCCCAGCTACTCGTGGGAGG + Intergenic
964775062 3:160266501-160266523 TAGTCCCAGCTACTTGGGAGAGG - Intronic
964970491 3:162553805-162553827 TAGCCCCAGCCACCATGGAGTGG - Intergenic
965115935 3:164487878-164487900 TAATTCCAGCTACTCGGGAGGGG + Intergenic
965945952 3:174241776-174241798 TAGTCCCAGCTGCTCGGGAGGGG - Intronic
966599860 3:181764371-181764393 TAATCCCAGCTACTCAGGAGGGG - Intergenic
966752668 3:183337435-183337457 TAATCCCAGCTACTTGGGAGAGG + Intronic
968178884 3:196575334-196575356 TAATCCCAGCTACTCGGGGGAGG + Intronic
968389781 4:181112-181134 TAGTCCCAGCTCCTCAGGAGAGG - Intergenic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
969553519 4:7889426-7889448 TAGCCCCAGCTACTCGGGAGAGG + Intronic
970492113 4:16585198-16585220 TAGCCCCAGCTACCCTGGCTGGG + Intronic
971295747 4:25389110-25389132 TAGTCCCAGCTACTCGGAGGAGG - Intronic
971455790 4:26842455-26842477 TAGTCCCAGCTACCCTGTGGTGG - Intergenic
972315926 4:37925594-37925616 TAGTCCCAGCTACTTAGGAGCGG + Intronic
972441473 4:39098012-39098034 TAGTCCCAGCTACACGTGGGAGG + Intronic
972494516 4:39621799-39621821 TAGTCCCAGCCACTCGGGATGGG - Intronic
972551552 4:40139917-40139939 TAGTCCCAGCTACTCAGGAGGGG - Intronic
972596416 4:40533768-40533790 TAGTCCCAGCTACTGGGGAGAGG - Intronic
973783276 4:54310924-54310946 TAGTCCCAGCTACTGAGGAGAGG - Intergenic
973891386 4:55370758-55370780 TAGTCCCAGATACTTGGGAGTGG + Exonic
975443974 4:74441599-74441621 TAGTCCCAGCTACTCAGGAGTGG - Intergenic
975641760 4:76507656-76507678 TAGTCCCAGCTACTCGGGAGGGG - Intronic
976873736 4:89828819-89828841 TAGTCCCAGCTACTTGGGAGGGG + Intronic
977007211 4:91583463-91583485 TAGCACCATCTACTCAGGAGTGG - Intronic
977696960 4:99976340-99976362 TAGTCCCAGCTACTCGGGGTTGG + Intergenic
977836603 4:101652602-101652624 TAGTCCCAGCTACTCGGGACAGG + Intronic
977938992 4:102837830-102837852 TAGTCCCAGCTACTCGGGAGAGG + Intronic
978544975 4:109861248-109861270 TAGTCCCAGCTACTCAGGTGAGG + Intronic
978743582 4:112166166-112166188 TAGTCCCAGCTACTCGGGAGAGG - Intronic
979539598 4:121866380-121866402 TAATCCCAGCTACTCAGGAGAGG - Intronic
979666700 4:123318665-123318687 TAGTCCCAGCTACTCGGTCGGGG + Exonic
979874926 4:125876468-125876490 TAGTCCCAGCTACTTGGGAGGGG + Intergenic
980031499 4:127837060-127837082 TAGTCCCAGCTACTCAGGAGAGG - Exonic
980344130 4:131590411-131590433 TAGCTCCATCTACACAGGAGGGG + Intergenic
981324049 4:143426429-143426451 TAGCCCCAGCTACGTAGGAGGGG + Intronic
981961918 4:150551557-150551579 TAGTCCCAGCTACTCAGGGGAGG + Intronic
981972209 4:150677680-150677702 TAGTCCTAGCTACTCAGGAGAGG + Intronic
982007671 4:151078947-151078969 TAGTCCCAGCTACTTGGGGGAGG - Intergenic
982184651 4:152783186-152783208 TAGTCCCAGCTACTTGGGAGGGG + Intronic
982870277 4:160570844-160570866 TAGTCCCAGCTACTCGGGAGGGG + Intergenic
983300837 4:165923551-165923573 TAGTCCCAGCTACTCAGGACAGG - Intronic
983985423 4:174053774-174053796 TAGTCCCAGCTACTTGGGGGAGG + Intergenic
984713776 4:182907255-182907277 TAGCCCCAGCTACTCCAGGGAGG - Intronic
984980892 4:185280047-185280069 TAGTCCCAGCTACTTGGGACTGG - Intronic
985555598 5:556484-556506 TAGTCCCAGCTACTGGGGGGAGG - Intergenic
987049006 5:14133965-14133987 TAGTCCCAACTACTCAGGAGAGG + Intergenic
987328249 5:16832064-16832086 TAGTCCCAGCTACCTGGTTGGGG - Intronic
987999484 5:25330676-25330698 CAGCTGCAGCCACCCGGGAGTGG + Intergenic
988492109 5:31713665-31713687 TAGTCCCAGCTACTTAGGAGGGG - Intronic
989160480 5:38386311-38386333 TAATCCCAGCTACTTGGGAGAGG - Intronic
990438304 5:55817585-55817607 TAATCCCAGCTACTCGGGAGAGG - Intergenic
990768319 5:59213278-59213300 TAGTCCCAGCTACTCTGGAGAGG - Intronic
991376227 5:65970706-65970728 TAGCCCCAGCTACACTTGGGAGG - Intronic
991525933 5:67557749-67557771 TAATCCCAGCTACTCAGGAGAGG + Intergenic
991729424 5:69569792-69569814 TAATCCCAGCTACTCGGGAGGGG - Intronic
991805859 5:70424931-70424953 TAATCCCAGCTACTCGGGAGGGG - Intergenic
991865528 5:71058088-71058110 TAATCCCAGCTACTCGGGAGGGG + Intronic
992083410 5:73256469-73256491 TAGTTCCAGCTACTGGGGAGTGG + Intergenic
992121679 5:73599918-73599940 TAATCCCAGCTACTCGGGGGAGG - Intergenic
992316211 5:75557906-75557928 TAATCCCAGCTACCAGGAAGTGG - Intronic
993228067 5:85195218-85195240 TAGTCCCAGCTACTCTGGAGAGG - Intergenic
993314336 5:86380827-86380849 TAGTCCCAGTTACTTGGGAGGGG - Intergenic
993399378 5:87430069-87430091 TAGTCCTAGCTACTCGGGGGAGG - Intergenic
993984294 5:94579039-94579061 TAGTCCCAGCTACGGGGGCGGGG - Intronic
995680649 5:114715094-114715116 TAGTCCCAGCTACTTGGGAAGGG - Intergenic
996783628 5:127215102-127215124 TAGTCCCAGCTACTTGGGGGAGG + Intergenic
996897310 5:128500562-128500584 TAGTCCCAGCTACTCGAGAGAGG - Intronic
996944837 5:129054701-129054723 TAATCCCAGCTACTCGGGGGAGG + Intergenic
997540421 5:134657064-134657086 TAGGCCCAGCTACTCAAGAGGGG + Intronic
997951105 5:138243134-138243156 TAATCCCAGCTACTTGGGAGGGG + Intergenic
997982847 5:138480413-138480435 TAGTCCCAGCTACTCGGGAATGG - Intergenic
997994906 5:138577615-138577637 TAATCCCAGCTACTCGGGGGAGG - Intergenic
998331823 5:141334455-141334477 TAGTCCCAGCTACGCGGGGCGGG + Intronic
999753721 5:154648826-154648848 CAGCCCCAGCCACTCTGGAGGGG - Intergenic
1001108086 5:168872758-168872780 TAGTCCCAGCTACTCGGGAGAGG - Intronic
1001173986 5:169447749-169447771 TAGTCCCAGCTACTCAGGAGGGG + Intergenic
1002486718 5:179543473-179543495 TAGTCCCAGCTACTCCGGAGAGG - Intergenic
1002903372 6:1428322-1428344 GAGCCCCAGTCACCCAGGAGAGG + Intergenic
1002926983 6:1610469-1610491 CAGCCCCAACTCCCTGGGAGTGG + Exonic
1003241436 6:4349028-4349050 TAGTCCCAGCTACTCGGGAGAGG - Intergenic
1004399113 6:15272001-15272023 TAGTCCCACCTACTCAGGAGAGG + Intronic
1004988544 6:21110846-21110868 TAGTCCTAGCTACCGGGGACAGG + Intronic
1005047647 6:21657349-21657371 TAGTCCCAGCTACTCAGGATGGG + Intergenic
1005111234 6:22284198-22284220 TAATCCCAGCTACCTGGGGGGGG + Intergenic
1005764047 6:28993186-28993208 TAGTCCCAGCTACTGGGGAGTGG - Intergenic
1005966821 6:30732470-30732492 TAGTCCCAGCTACTCTAGAGGGG - Intronic
1006531005 6:34653847-34653869 TGGACCCAGCTACTCAGGAGAGG + Intronic
1006689261 6:35866463-35866485 TAGTCCCAGCTACGCGGGAAGGG + Intronic
1006760544 6:36456788-36456810 TAGTCCCAGCTACTCAGGAGTGG - Intronic
1006777897 6:36610380-36610402 TAATCCCAGCTACTGGGGAGGGG + Intergenic
1006843889 6:37049715-37049737 TAGTCCCAGCTACTAGGGTGTGG - Intergenic
1007141412 6:39578446-39578468 TAGTCCCAGCTACTCGGCTGAGG - Intronic
1007453659 6:41959562-41959584 TAATCCCAGCTACTCGGGATGGG + Intronic
1007530013 6:42533819-42533841 TAGTCCCAGTTACTCAGGAGGGG + Intergenic
1007558741 6:42788014-42788036 TGGTCCCAGCTACTCAGGAGAGG - Intronic
1007986458 6:46211963-46211985 TAGTGCCAGCTACCTTGGAGGGG + Intergenic
1008124872 6:47656624-47656646 TATCTCCAGCTGCCAGGGAGTGG + Intronic
1011052800 6:83172278-83172300 CAGTCCCAGCTACTCAGGAGAGG + Intronic
1011531009 6:88321007-88321029 TAGTCCCAGCTACCTGGGGTGGG - Intergenic
1011644000 6:89440667-89440689 TAGTCCCAGCTACTTGGGAGAGG + Intronic
1012284638 6:97374185-97374207 TAGTCCCAGCTACTCGGGAGGGG - Intergenic
1013251656 6:108340482-108340504 TAATCCCAGCTACTTGGGAGAGG - Intronic
1014010844 6:116473773-116473795 TAGTCCCAGCTACGGGGGGGGGG + Intergenic
1014259494 6:119199790-119199812 TAGTCCCAGCTACTCGGGGCGGG + Intronic
1014805540 6:125825218-125825240 TAACCCTAGCTACTCTGGAGTGG + Intronic
1015273698 6:131363019-131363041 TACTCCTAGCTACCAGGGAGAGG + Intergenic
1015437597 6:133207468-133207490 CAGCCCTAGCTACAGGGGAGAGG + Intergenic
1015504476 6:133968106-133968128 TAGTCCCAGCTACTTGGGGGAGG - Intronic
1016464040 6:144308407-144308429 TAGCCCCAGCTACCCGAGGGTGG - Intronic
1016950353 6:149573749-149573771 TAGTCCCAGCTACTCCTGAGAGG + Intronic
1017127272 6:151077929-151077951 TAGCCCCAGCTACTCCGGAGAGG + Intronic
1017914858 6:158823737-158823759 TAGTCCCAGCTACTTGGGTGAGG - Intergenic
1018010708 6:159667378-159667400 TAGTCCCACCTACTTGGGAGGGG + Intergenic
1018306440 6:162461699-162461721 TAACCCCAGCTACTCGGGGCGGG + Intronic
1018625871 6:165778188-165778210 TAGTCCCAGCTACTCGGGAGAGG - Intronic
1019004041 6:168781311-168781333 TAGTCCCAGCTACTTGGGACTGG + Intergenic
1019753683 7:2751264-2751286 TAGTCCCAGCTACTCAGCAGGGG + Intronic
1020341736 7:7118344-7118366 TAGTCCCAGCTACTTAGGAGGGG + Intergenic
1020477049 7:8608454-8608476 TAGTCCCAGCTAATCAGGAGTGG - Intronic
1021362446 7:19732451-19732473 TAGTCGCAGCTACTCTGGAGGGG + Intronic
1022204197 7:28147760-28147782 TAGTGTCAGCTACCTGGGAGTGG + Intronic
1022356776 7:29623197-29623219 TAGTCCCAGCTACTCGGAAAGGG - Intergenic
1023073085 7:36457125-36457147 TAATCCCAGCTACTCCGGAGGGG - Intergenic
1023465571 7:40450656-40450678 TAGTCCCAGCTACTCGGCTGAGG + Intronic
1023933906 7:44725473-44725495 TAGTTCCAGCTACTCGGGAGGGG - Intergenic
1024110957 7:46145884-46145906 TAATCCCAGCTACTCGGGAGGGG + Intergenic
1025079964 7:55972982-55973004 TAGTCCCAGCTACTTGGGAGGGG + Intronic
1025172007 7:56767504-56767526 TAGTCCCAGCTCCTTGGGAGGGG + Intergenic
1025756253 7:64345607-64345629 TAGTCCCAGCTACTCAGGAGAGG + Intronic
1025917683 7:65878784-65878806 TAGTCCCAGCTACTTGAGAGGGG + Intronic
1026452700 7:70543368-70543390 TAATCCCAGCTACTCGGGAGGGG + Intronic
1026921735 7:74160647-74160669 TAGACCCAGCTACTCGCGGGGGG + Intergenic
1026968000 7:74452823-74452845 TAGGCCAAGCTAACCGGGGGAGG - Intergenic
1028891385 7:95991977-95991999 TAATCCCAGCTACTCGGGATGGG - Intronic
1029213598 7:98929056-98929078 TAATCCCAGCTACTCAGGAGGGG - Intronic
1029457155 7:100677153-100677175 TAGTCCCAGCTATGCGGGGGAGG + Intronic
1029571984 7:101376039-101376061 TAGTCCCAGCTACTTGGGAGAGG + Intronic
1029572007 7:101376190-101376212 TAGTCCCAGCTACCTGGGAGGGG + Intronic
1030019366 7:105257985-105258007 TAGTCCCACCTACTCTGGAGGGG + Intronic
1030224810 7:107138533-107138555 TAGTCTCAGCTACTCAGGAGAGG - Intronic
1030224824 7:107138667-107138689 TAGTCTCAGCTACTCAGGAGAGG - Intronic
1031667748 7:124505309-124505331 TAATCTCAGCTACTCGGGAGAGG + Intergenic
1031694464 7:124832696-124832718 TAGTCCCAGCTACTCGGCGGGGG + Intronic
1031828353 7:126595317-126595339 TAGTCCCAGCTACTGGGGAAGGG - Intronic
1032401764 7:131629104-131629126 TTGCCCCAGCCAGCTGGGAGGGG - Intergenic
1032438697 7:131924163-131924185 TAATCCCAGCTACTCGGGGGAGG - Intergenic
1032494567 7:132351509-132351531 TGGCTCCAGCTTCCTGGGAGGGG + Intronic
1033068099 7:138175578-138175600 TAGTCCCAGCTACTTGGGGGAGG + Intergenic
1033133024 7:138761513-138761535 TAGTCCCAGCTACTCGGCTGAGG + Intronic
1033255661 7:139799349-139799371 TAGTCCCAGCTACTTGGGGGAGG - Intronic
1033825557 7:145185882-145185904 TAGTCCCAGCTACTCGGGGGGGG + Intergenic
1034094948 7:148398964-148398986 TAGCCCCAGTTTCTAGGGAGAGG - Intronic
1034713489 7:153218215-153218237 TAGTCCCAGCAACTCGAGAGAGG + Intergenic
1034777055 7:153837788-153837810 TAGTCCCAGCTACTCAGGAGGGG - Intergenic
1035290003 7:157831733-157831755 CAGCCCCAGCTGCCTGGGGGAGG - Intronic
1035429601 7:158808852-158808874 TAGTCCCAGCTACTTGGGAGGGG + Intronic
1035828009 8:2665172-2665194 AAGCCCCAGCCACCTGGGGGCGG + Intergenic
1035888964 8:3323930-3323952 TAACCCCAGAGACCCAGGAGGGG + Intronic
1035889029 8:3324216-3324238 CAACCCCAGAGACCCGGGAGGGG + Intronic
1036783347 8:11666358-11666380 TAGTCCCAGCTACTCAGGAAGGG + Intergenic
1036934443 8:12987568-12987590 TAGTCCCAGATACTTGGGAGGGG + Intronic
1037543085 8:19890572-19890594 TAGTCCCAGCTACTCAGGAGAGG + Intergenic
1038442664 8:27582874-27582896 TGGTCCCAGCTACACGGGGGAGG - Intergenic
1038551361 8:28472209-28472231 TAGTCCCAGCTACTTGGGATGGG - Intronic
1038554580 8:28498691-28498713 TAGGCCCAGCTATTCAGGAGGGG - Intronic
1038865412 8:31434210-31434232 TAGTCCCAGCTACTCAGGAGAGG + Intergenic
1039040902 8:33407881-33407903 TAGTCACAGCTACTCGGGATCGG + Intronic
1039634774 8:39152600-39152622 TAATCCCAGCTACTCGGGAGCGG + Intronic
1039751611 8:40483770-40483792 TAATCCCAGCTACTTGGGAGAGG + Intergenic
1040063007 8:43120614-43120636 TACCCCCAGCTACTCAGGGGAGG - Intronic
1040543815 8:48381586-48381608 TAGGCCCAGCTACTGGGGAGGGG - Intergenic
1042142517 8:65693667-65693689 GAGTCCCAGCCACCCAGGAGAGG + Exonic
1042515129 8:69651170-69651192 CAATCCCAGCTACTCGGGAGGGG - Intronic
1042549641 8:69982888-69982910 TAGTCCCAGCTACTCAGGAGGGG - Intergenic
1044709109 8:95038462-95038484 TAGCCCCAGCTACCCGGGCCTGG - Intronic
1044902129 8:96957960-96957982 TAGTCCCAGCTACTGGAGAGGGG - Intronic
1045026782 8:98094998-98095020 TAGTCCCAGCTACTCAGGAGAGG - Intergenic
1045480381 8:102586834-102586856 TAGTCCCAGCTACTTGGGATGGG + Intergenic
1045519217 8:102888793-102888815 TAGTCCCAGCTACTCAGGAGGGG + Intronic
1045673016 8:104577689-104577711 TAGTCTCAGCTACTCGGGAGGGG + Intronic
1047566110 8:126046384-126046406 TGGCCCCTGCTACCCTGGGGCGG - Intergenic
1048393048 8:133986239-133986261 TAGTCCCAGCTACTTGGGAGGGG + Intergenic
1048402322 8:134083502-134083524 TAATCCCAGCTACTCAGGAGCGG - Intergenic
1048867675 8:138772739-138772761 TAGTCCCAGCTACTCAGGAGAGG + Intronic
1049156406 8:141069546-141069568 TAGTCCCAGCTACTCAGGCGGGG - Intergenic
1049493022 8:142915001-142915023 CAGCCCCAGAGACCCTGGAGTGG - Intronic
1049542219 8:143213777-143213799 AAGCCTCAGCTACCCGGGTATGG - Intergenic
1050512604 9:6412030-6412052 TAGTCCCAGCTACCCCAGGGAGG + Intergenic
1050814870 9:9797724-9797746 TAATCCCAGCTACTCGGGGGGGG + Intronic
1051130182 9:13851693-13851715 TAGTCCCAGCTACTCGGGGGAGG + Intergenic
1051263102 9:15285143-15285165 TAGTCCCAGCTACTCGGGGCGGG + Intronic
1051270018 9:15346364-15346386 TAGCCCCAGCTACTCAGAAGTGG + Intergenic
1052322672 9:27184918-27184940 TAGTCCCAGCTACTTGGGTGAGG + Intronic
1052535230 9:29737831-29737853 TAGCCCCAGCTACTCAGGAGAGG + Intergenic
1053225283 9:36349936-36349958 TAATCCCAGCTACTCGGGAGGGG - Intronic
1053226171 9:36359866-36359888 TAGTCCCAGCTACTCGGGGCGGG - Intronic
1053246625 9:36539721-36539743 TAATCCCAGATACTCGGGAGGGG + Intergenic
1054798478 9:69324843-69324865 TAGCCCCAGCTCGGCGGGTGGGG + Intronic
1054975024 9:71133417-71133439 TAATTCCAGCTACTCGGGAGGGG - Intronic
1055450489 9:76426775-76426797 TAATCCCAGCTACTCGGGGGTGG + Intronic
1055940558 9:81645237-81645259 TAATCCCAGCTACTTGGGAGGGG + Intronic
1056400731 9:86224817-86224839 TAGTCCCAGCTACATGGGAGAGG + Intronic
1056630116 9:88286569-88286591 TAATCCCAGCTACTCGGGATGGG + Intergenic
1056986697 9:91370211-91370233 TAGTCCCAGCTACTGGGGTGGGG + Intergenic
1057045867 9:91885993-91886015 TAATCCCAGCTACTCGGGAGAGG - Intronic
1057093055 9:92277556-92277578 TAGTCCCAGCTACTCGGGATGGG + Intronic
1057130955 9:92654395-92654417 TAGTCCCAGCTACTTGGGGGTGG + Intronic
1058142332 9:101370432-101370454 TAGTCCCAGCTACTCAGCAGGGG - Intronic
1059190171 9:112317825-112317847 TAATCCCAGCTACTCAGGAGAGG + Intronic
1059219129 9:112595539-112595561 TAACCCCAGCTACTGGGGTGGGG + Intronic
1060178053 9:121512031-121512053 TAGTCCCAGCTACTCGGGGAGGG - Intergenic
1060603202 9:124891762-124891784 TAGTCCCAGCTACTCGGGAGGGG - Intronic
1060927160 9:127463075-127463097 TAATCCCAGCTACTCGGGGGAGG + Intronic
1061018441 9:127997240-127997262 TATTCCCAGCTACTCAGGAGGGG - Intergenic
1061162786 9:128905051-128905073 TAGCCCCAGCTACCTGGGGGAGG + Intronic
1061177089 9:129004155-129004177 TAGTCCCAGCTACTCAGGATCGG + Intronic
1061199996 9:129132456-129132478 TAGTCCCAGGTACTGGGGAGTGG - Intronic
1061307473 9:129740374-129740396 TAGCCCCTTCTACTCGGGAGGGG - Intronic
1061416361 9:130449209-130449231 TAGTCCCAGCTACTTGGGGGTGG + Intronic
1061560463 9:131399154-131399176 TAGTCCCAGCTACTCAGGAGGGG + Intronic
1061742113 9:132714853-132714875 TAGTCCCAGCTACTCGGGAGAGG + Intergenic
1061910796 9:133721994-133722016 TAATCCCAGCTACTCAGGAGTGG + Intronic
1203753350 Un_GL000218v1:100169-100191 TAGTCCCAGCTACTCGGCTGAGG + Intergenic
1185455558 X:308853-308875 TAGTCCCAGCTACTCAAGAGAGG - Intronic
1185563486 X:1078743-1078765 TAGTCCCAGCTACTTGGGAGAGG - Intergenic
1185639748 X:1582731-1582753 TAGTCTCAGCCACTCGGGAGGGG - Intergenic
1185665173 X:1759972-1759994 TAGTCCCAGCTACTTGGGAGAGG + Intergenic
1185738669 X:2512848-2512870 TAGTCCCAGCTACTTGGGGGTGG + Intergenic
1185840014 X:3380519-3380541 TATTCCCAGCTACCTGGGAGTGG + Intergenic
1185857045 X:3545262-3545284 TAGTCCCAGCTACTTAGGAGGGG + Intergenic
1186023144 X:5279581-5279603 TAATCCCAGCTACTCGGGAGAGG + Intergenic
1187366551 X:18670345-18670367 TAATCCCAGCTACTCGGGGGAGG - Intronic
1187446454 X:19365082-19365104 TAATCCCAGCTACTCGGGAGGGG + Intronic
1187968019 X:24631843-24631865 TAATCCCAGCTACTCGGGAGGGG + Intronic
1189029711 X:37438090-37438112 TAGTCCCAGCTACTCGAGAGGGG + Intronic
1189294882 X:39910982-39911004 GAGCTCCAGCTCCCAGGGAGGGG + Intergenic
1189805017 X:44726939-44726961 TAGTCCCAGCTACTCAGGAGAGG + Intergenic
1190468403 X:50750379-50750401 TAATCCCAGCTACTCGGGGGAGG - Intronic
1190750883 X:53360346-53360368 TAATCCCAGCTACCTGGGGGAGG + Intergenic
1190791952 X:53708705-53708727 TAGTCCCAGCTACTCAGGAGAGG - Intergenic
1190827945 X:54034877-54034899 TAGTCCCAGCTACTGGGGGGTGG + Intronic
1191626310 X:63274899-63274921 TAGCTTCAGCTACCCTAGAGTGG - Intergenic
1193117876 X:77793009-77793031 TAGTCCGAGCTACTCTGGAGAGG + Intergenic
1194654867 X:96560382-96560404 TAGTCCCAGCTACTTGGAAGGGG - Intergenic
1195716533 X:107824314-107824336 TAATCCCAGCTACTCAGGAGGGG - Intergenic
1196177482 X:112655685-112655707 TAGTCCCAGCTACTTGGGAAGGG - Intronic
1196434340 X:115661329-115661351 TAGTCCCAGCTACTCGGGTGGGG + Intergenic
1196729795 X:118929295-118929317 TAGTCCCAGCTACCTTGGTGAGG + Intergenic
1197211112 X:123828851-123828873 TAGTCCCAGCTACTCGGGTGAGG + Intergenic
1198071025 X:133148630-133148652 TGGTCCCAGCTACTAGGGAGGGG + Intergenic
1198745766 X:139888925-139888947 TAGTCCCAGCTACTCGGAGGCGG - Intronic
1198750966 X:139935868-139935890 TAATCCCAGCTACTCGGGATCGG + Intronic
1200203729 X:154300810-154300832 TAGTCCCAGCTACTCGGGTAAGG - Intronic
1200329245 X:155278814-155278836 TAGTCCCAGCTACTCAAGAGTGG + Intronic
1201239808 Y:11947755-11947777 TAGTCCCAGCTACTCGGGAGAGG - Intergenic
1201764991 Y:17567541-17567563 CAGTCCCAGCTACCCGGTGGAGG + Intergenic
1201836561 Y:18338448-18338470 CAGTCCCAGCTACCCGGTGGAGG - Intergenic