ID: 1106537741

View in Genome Browser
Species Human (GRCh38)
Location 13:30662706-30662728
Sequence CAGTGTGAACTGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106537737_1106537741 -2 Left 1106537737 13:30662685-30662707 CCCCAAAAATACACTTGTTTACA 0: 1
1: 1
2: 8
3: 59
4: 580
Right 1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG 0: 1
1: 0
2: 0
3: 33
4: 330
1106537738_1106537741 -3 Left 1106537738 13:30662686-30662708 CCCAAAAATACACTTGTTTACAG 0: 1
1: 0
2: 2
3: 34
4: 275
Right 1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG 0: 1
1: 0
2: 0
3: 33
4: 330
1106537736_1106537741 -1 Left 1106537736 13:30662684-30662706 CCCCCAAAAATACACTTGTTTAC 0: 1
1: 0
2: 3
3: 48
4: 349
Right 1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG 0: 1
1: 0
2: 0
3: 33
4: 330
1106537739_1106537741 -4 Left 1106537739 13:30662687-30662709 CCAAAAATACACTTGTTTACAGT 0: 1
1: 0
2: 8
3: 34
4: 271
Right 1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG 0: 1
1: 0
2: 0
3: 33
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106537741 Original CRISPR CAGTGTGAACTGAAAGAGGA AGG Intergenic
903726176 1:25447170-25447192 CAATGGGAAATGGAAGAGGAGGG - Intronic
903874323 1:26462468-26462490 CAGTAGGAAATGAAAGAGGGAGG - Intronic
904204677 1:28846203-28846225 CCATGTGAAGTGAAGGAGGAAGG - Intronic
907096797 1:51789396-51789418 AAGTATGAACTGGAAGAGGATGG - Exonic
907562797 1:55406325-55406347 CAGTGAGACCTCAAAGAGGAAGG - Intergenic
907710449 1:56875933-56875955 CAGTGAGAACAGAAAGAGAATGG + Intronic
908482095 1:64551249-64551271 CACAGAGAACTGAAAGAAGATGG - Intronic
908825941 1:68132643-68132665 TAGCGTGAACAGAAATAGGAGGG + Intronic
909669175 1:78168884-78168906 CACTGTGTATTGAGAGAGGAAGG - Intergenic
909829921 1:80175065-80175087 CAGTGAGAACTGCTAGAGGGAGG + Intergenic
910434736 1:87194211-87194233 TACTTTGAACTGAAAGAGAAAGG + Intergenic
911860708 1:102944481-102944503 CTGGGATAACTGAAAGAGGATGG + Intronic
912222636 1:107695795-107695817 CAGTGTTAAATGAAAGAGAAAGG + Intronic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912667993 1:111600241-111600263 CAATGTGAGCTGAAAGAAGAGGG - Intronic
912724876 1:112050231-112050253 CAGTGTTAACTGGGACAGGAAGG - Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
915311571 1:155008132-155008154 CTGTGGGCACCGAAAGAGGAAGG - Intronic
915656690 1:157366612-157366634 CAGTGGGTCCTGAAAAAGGAAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915864671 1:159486223-159486245 CAGTGTGAACACAAAGGTGAAGG + Intergenic
915952637 1:160199731-160199753 CAGTGCGAACTGGCAGTGGATGG - Intronic
918076848 1:181177072-181177094 CACTGTGAGCTGGAAGAGGCAGG + Intergenic
918593224 1:186262850-186262872 CAGAGTGAACTGGAAGTGGATGG + Intergenic
919412531 1:197264149-197264171 GAGTGTGAAATGATAGATGATGG - Intergenic
919429384 1:197473921-197473943 TAGAGTGAACTGAATGAGTAGGG - Intronic
919493467 1:198234846-198234868 CAGTGTGAATGCAGAGAGGAGGG - Intronic
920353857 1:205356093-205356115 CACTGGGAACTCAAAAAGGAGGG - Intronic
920830150 1:209457222-209457244 CAGTGTGGAAAGAAAGAGAAAGG - Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
921087606 1:211810738-211810760 CATTGTGAGCTGAAATATGAAGG + Intronic
921487319 1:215730446-215730468 GAGAGAGAGCTGAAAGAGGAGGG - Intronic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922292357 1:224218992-224219014 CAGTCTGAGCTGAAAGCAGATGG + Intergenic
922449885 1:225728464-225728486 GAGTGTGCATTGAAAGGGGAGGG + Intergenic
923193808 1:231645001-231645023 CACAGTGAACAGAAAGAGGCTGG - Intronic
924005157 1:239600816-239600838 CAATGTGAAAGTAAAGAGGAAGG - Intronic
924180225 1:241433522-241433544 CAGTCAGAACCCAAAGAGGATGG + Intergenic
924225964 1:241921861-241921883 CAGTATGACCTGTAAGAAGAGGG + Intergenic
924658870 1:245997962-245997984 CAGTGGGATCAGAAAGAGGTTGG - Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1065092376 10:22247739-22247761 CAGTGTGAACTGAGTGAGCCAGG - Intergenic
1065536674 10:26721858-26721880 CTGTCAGAACTGAAAGAGGCAGG - Intronic
1065643927 10:27814883-27814905 GAGGTTGAACTGATAGAGGATGG - Intronic
1065799081 10:29334796-29334818 GAGGGTGAACTGAAATAGGGCGG + Intergenic
1065860068 10:29864963-29864985 CAATGTGATCTGAAACAGGGTGG - Intergenic
1067285677 10:44906037-44906059 CAATGGGAACTGAATGAGCATGG + Intergenic
1067517836 10:46968832-46968854 CAGTGGGAACTGAGAGATGGGGG - Intronic
1067578912 10:47426938-47426960 CAGTGGGATCTGCTAGAGGATGG + Intergenic
1067644412 10:48082997-48083019 CAGTGGGAACTGAGAGATGGGGG + Intergenic
1069614750 10:69800046-69800068 GATTGGGAACTGAAAGAGGAGGG - Intergenic
1069653235 10:70066854-70066876 CATTGTGAGCTGAAACAAGAAGG - Intronic
1069779641 10:70946577-70946599 CAGTGTGCCCTGAAATGGGAAGG + Intergenic
1070085143 10:73229771-73229793 CATTCTGAAGAGAAAGAGGAAGG + Intronic
1070602255 10:77873976-77873998 CAGTGTGAGCTGGAGGAGGGCGG - Intronic
1071745448 10:88413674-88413696 AAGAGTTATCTGAAAGAGGAAGG - Intronic
1073694457 10:105849502-105849524 GAGGGTGAGCTGAAAGAGGGTGG + Intergenic
1073733108 10:106314500-106314522 CACTCTGAACTAAGAGAGGAAGG - Intergenic
1074814118 10:117132024-117132046 CAGTGGGAAATTAAGGAGGAGGG + Intronic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076923991 10:133472136-133472158 CTGTGTGAGCTGACAAAGGAGGG + Intergenic
1077246334 11:1541026-1541048 CAGTGTGAAGAGACACAGGAAGG + Intergenic
1077741735 11:4854239-4854261 GAGTGTGAGCTGAAACAGGGCGG + Intronic
1077858651 11:6155657-6155679 CAGTATGGAGTGAAACAGGACGG + Intergenic
1079043573 11:17080245-17080267 CAGTGCCAACAGCAAGAGGAAGG - Intronic
1079509348 11:21192894-21192916 CAGTGTCGAGAGAAAGAGGAAGG + Intronic
1081569238 11:44279320-44279342 CAGTGGGAACTGCAGAAGGAAGG - Intronic
1081744816 11:45465370-45465392 CAGTGTGCAGTGAAACTGGAAGG - Intergenic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1084102055 11:66956262-66956284 CAATTAGAACTGGAAGAGGAAGG - Intronic
1085051713 11:73383352-73383374 AGCTGTGAACTGAAAGAGGCAGG - Intronic
1085804566 11:79623245-79623267 CTGTGGGAATTGATAGAGGAAGG - Intergenic
1086614552 11:88800716-88800738 CATTAGGAACTGATAGAGGAGGG - Intronic
1086747948 11:90453787-90453809 AGGTGTGAACATAAAGAGGAAGG - Intergenic
1087183964 11:95166819-95166841 AAATGTGAAGAGAAAGAGGAAGG + Exonic
1087832369 11:102832885-102832907 CACTCTGAACTGAAACAAGAAGG + Intergenic
1087890067 11:103527823-103527845 CGGTGTGAAATGAAAAATGAGGG + Intergenic
1088908871 11:114175693-114175715 CAGTGGGAAATGAGAGAGGCAGG + Intronic
1090450059 11:126798239-126798261 CAGTGTGTTCTGAGAGAGGAAGG - Intronic
1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG + Intergenic
1091628356 12:2139810-2139832 CAGTGTGAACTGGAGGTGTAAGG + Intronic
1094161875 12:27399237-27399259 CAGTGAGAACTGAGAGAGAGCGG - Intronic
1096403615 12:51326851-51326873 AAGGGGGAACTGAAAGGGGAAGG - Intergenic
1097193328 12:57230674-57230696 TAGTGAGAACTGAAACAGGCTGG + Intronic
1097388848 12:58984410-58984432 CGGTGAGACCTGAAAGAGGAAGG + Intergenic
1097653159 12:62328724-62328746 CAGTTTTGACAGAAAGAGGAAGG + Intronic
1097998678 12:65917686-65917708 CAGTAAGAACTGAAAAAGGCTGG + Intronic
1098033687 12:66280713-66280735 AAGCGTGCTCTGAAAGAGGAAGG - Intergenic
1098246072 12:68519326-68519348 CAGTGAGGCCTGAAGGAGGAAGG - Intergenic
1098554532 12:71803808-71803830 CAGTGTGAACTTTCATAGGAAGG - Intergenic
1099902835 12:88734031-88734053 CAGAGTGAACTCATAGAGGAGGG + Intergenic
1101320517 12:103669300-103669322 CTGTGCGAACAGACAGAGGAAGG - Intronic
1102890115 12:116552226-116552248 CAGTGTGAAATGAAAAAAGTAGG + Intergenic
1103572779 12:121856289-121856311 CTGGGTGGACTGAGAGAGGAAGG - Intronic
1103893150 12:124254872-124254894 CTGTTGGAGCTGAAAGAGGAGGG + Intronic
1104834126 12:131776362-131776384 CAGTGTAAACGGAAACAGCAAGG + Intronic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1106123076 13:26878010-26878032 CAGGGTGAACTGAATGGTGAAGG + Intergenic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1106872590 13:34037801-34037823 CTGTGTGTCCTGGAAGAGGAGGG - Intergenic
1107822332 13:44297014-44297036 CAGTGTGAGCTTAAGAAGGAGGG - Intergenic
1108852264 13:54745973-54745995 CAATGTGAAGTGGAAGAGGAGGG - Intergenic
1109277722 13:60321331-60321353 CCATTTAAACTGAAAGAGGAAGG + Intergenic
1110805674 13:79751525-79751547 CAGGGTGATCTGAAAGGGAAAGG - Intergenic
1111396100 13:87671958-87671980 CAGTGTGCGCTGCAAGAAGAAGG + Intergenic
1112568548 13:100572137-100572159 AAGTGTCCACTGACAGAGGAAGG + Intronic
1114296441 14:21333778-21333800 CTGTCTCAACTGAAAGAGTACGG - Intronic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1114478051 14:23011451-23011473 CAGTCTGTGCTGAAAGAGAATGG - Intergenic
1115257419 14:31417825-31417847 CAGTGTGTAATGATAGAGGAAGG - Intronic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118102756 14:62624936-62624958 GTGTGTGAAAGGAAAGAGGAGGG - Intergenic
1118338642 14:64877067-64877089 CAGTGTGATAGGACAGAGGATGG - Intronic
1121325485 14:93017340-93017362 CAGTGTGAAGTGCAAGTGGCTGG - Intronic
1122181844 14:99960888-99960910 CATTGTTAAGTGAAAGAAGACGG - Intergenic
1123756746 15:23402847-23402869 CAGTGTGGACTGGAAGATGGCGG - Intergenic
1127288287 15:57549163-57549185 CATTGTGAAGTGACACAGGAAGG - Exonic
1127488640 15:59441581-59441603 CAGTTTCAACAGAAAGATGAGGG - Intronic
1127674342 15:61226733-61226755 CAGTCTGAATGGAAAAAGGAAGG - Intronic
1128637431 15:69312146-69312168 CAATCAGAACTGAAAGAGGCTGG + Intronic
1129991271 15:79965522-79965544 CAGAGTCAAGTGAGAGAGGAAGG + Intronic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130334651 15:82948663-82948685 AAGTCTGAAAGGAAAGAGGAAGG + Intronic
1130633664 15:85595982-85596004 CTGTATGAAATGAAAGAGGCAGG - Intronic
1131456235 15:92584710-92584732 GAGTGGGATCTGAAAGACGATGG - Intergenic
1131638069 15:94259101-94259123 CAGAGTGAACTGAGTGAGCATGG - Intronic
1133553329 16:6880601-6880623 AAATGTGAACTGGAAGAGGCAGG + Intronic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1137011245 16:35322640-35322662 CAGTATGAACTGATATATGATGG - Intergenic
1139153904 16:64417895-64417917 CATTGTGAATTGAAGGAGGCAGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140799915 16:78476928-78476950 AAGAGGGAACTGAAGGAGGAAGG - Intronic
1141635601 16:85312394-85312416 CAATGGGAACTGGAAGAGGCAGG - Intergenic
1142985197 17:3691090-3691112 CAGCGTTACCTGAAAGAGGGCGG + Intronic
1143117271 17:4588164-4588186 CAGTGTGAACTGTCTTAGGATGG + Intronic
1144260774 17:13517982-13518004 CAGAGTCAACTGGGAGAGGAAGG + Intronic
1145065821 17:19760442-19760464 CAGTGTGAGCTGAAGGCGCATGG - Intergenic
1145197528 17:20907982-20908004 CAGTGTGATCTGAAAAATTAGGG + Intergenic
1145305607 17:21673372-21673394 CAGAGCGACCTGAAAGAAGATGG - Intergenic
1147376386 17:40024674-40024696 AAGTGTCCACTGACAGAGGAGGG + Intronic
1149433140 17:56610512-56610534 CAGTGTGAAATGGAGAAGGAAGG - Intergenic
1150115157 17:62541077-62541099 CAGAGGGAACTGAGAGAGCAGGG - Intronic
1150580463 17:66469116-66469138 GAATGTGGACAGAAAGAGGAAGG - Intronic
1153045057 18:848354-848376 AAGTGGGAAGTGAAGGAGGAAGG - Intergenic
1153217238 18:2832098-2832120 CAGTGTGAGCTGAAACAAGAAGG - Intergenic
1154200838 18:12299240-12299262 CATTGTTAACTGAAAAAAGATGG - Intergenic
1155490902 18:26400987-26401009 CTGTGAGAACTGAAAGAGCTGGG - Intergenic
1156561374 18:38129603-38129625 CAGTGAGAAGAGAAAGGGGAAGG - Intergenic
1157563042 18:48662030-48662052 AAGTGAGAACTGCAAGAGGCCGG + Intronic
1158155723 18:54423371-54423393 GAGTGTGAAGGGAAAAAGGAGGG + Intergenic
1160142776 18:76340072-76340094 CAGTGTAAAATGAAAATGGAGGG - Intergenic
1160209102 18:76861327-76861349 CAGTGAGAACGGGAGGAGGAAGG + Intronic
1162747553 19:12807132-12807154 AGGTGAGAACTGAAAGGGGAGGG + Intronic
1163130728 19:15271203-15271225 CAGTGGGAACTGAAGCAGGGAGG - Intronic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1165906757 19:39199023-39199045 CCGTGGGAACTGAGAGTGGAAGG + Intronic
925838212 2:7966086-7966108 CAGTGTGAGCTCAAGGAGGTTGG - Intergenic
926566514 2:14481442-14481464 CAGAGTGCACTGAAAGAAGCAGG + Intergenic
927300085 2:21502053-21502075 CAGTGAGACATGAAAAAGGAAGG + Intergenic
928194140 2:29202160-29202182 CAGTGTGAACAGCCAGAGGCAGG - Intronic
928753535 2:34497601-34497623 CAGTGTGAAATAAAGCAGGAGGG + Intergenic
929244633 2:39687713-39687735 CAGTGTGAAAGCAAAGGGGATGG + Intronic
930523103 2:52492751-52492773 CAGTGAGTTCTGAGAGAGGAAGG - Intergenic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931220199 2:60282582-60282604 AGGTGTGAACTGTGAGAGGATGG - Intergenic
932419083 2:71590868-71590890 CAGTGTGACATTAAAGAGGAGGG - Intronic
933120584 2:78531896-78531918 CAGTGTAAACTGTATGAGCAAGG + Intergenic
933441944 2:82325611-82325633 CAGTGTGAACCCAAAGAGTGAGG + Intergenic
936616406 2:114052191-114052213 CAGTGGTAATTGAAATAGGAGGG - Intergenic
936729931 2:115369705-115369727 AAGTGTGAAATGACAAAGGATGG + Intronic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
937919861 2:127121404-127121426 CACTGTAAACTCAAAGATGAAGG + Intergenic
938120198 2:128627636-128627658 GAGTGTGGACTGCGAGAGGATGG - Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938667933 2:133558451-133558473 CAGAGAGATGTGAAAGAGGAAGG + Intronic
938951047 2:136254780-136254802 CAGTGTGATCTTAATGAGGTAGG + Intergenic
939746789 2:145981811-145981833 CAGAGTTATCTGAAAGAGAATGG - Intergenic
939899061 2:147827911-147827933 CAGTGTGGACCCAAAGAGTAAGG - Intergenic
943079128 2:183236207-183236229 CAGTGTAAACAGAAAGAATAGGG + Intergenic
943477118 2:188370485-188370507 AATTGTGAACTAAATGAGGAGGG - Intronic
943686228 2:190821222-190821244 CAGACTGAAATGAAAGAGGAAGG - Intergenic
943794446 2:191974306-191974328 CAGACTCAACTGAAAGAAGAAGG - Intronic
945090962 2:206175205-206175227 CAATGGGAAGTGGAAGAGGAGGG - Intergenic
946959752 2:224971428-224971450 GGGTGTGAAGTGAAAGAGGTGGG + Intronic
947238017 2:227964089-227964111 CAGTGTAAAATGAAAGTGTAGGG - Intergenic
947447773 2:230177713-230177735 CAGGGTGAATTCACAGAGGATGG - Intronic
947865931 2:233397732-233397754 GAGGGTGAACTGGAAGGGGAGGG + Intronic
948935608 2:241162368-241162390 GAGAGTGAACTGACAGAGGAGGG + Intronic
949077292 2:242069024-242069046 GAGAATGAAGTGAAAGAGGAGGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168810874 20:703788-703810 CAGTGTGAACAGGAAGTTGACGG + Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169933537 20:10858692-10858714 CAGTGGAAACTGCAAGAGCAGGG + Intergenic
1169967401 20:11232831-11232853 CAGTGGAAACTGACAGAGGATGG + Intergenic
1170565244 20:17597614-17597636 CAGTGTGAAATAAAAGACAATGG - Intronic
1171396992 20:24841443-24841465 CACTGGGGACTGATAGAGGAGGG + Intergenic
1172109167 20:32535575-32535597 CAGCGTGATTTGAAAGAAGATGG - Intronic
1172967288 20:38845995-38846017 CTGTGTCAAGTGACAGAGGAGGG + Intronic
1173349753 20:42233927-42233949 CAGTGTGAAAGGACAGAGGATGG - Intronic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174514417 20:51080643-51080665 CAGCGTGAACTTTGAGAGGATGG - Intergenic
1176752229 21:10700144-10700166 CAGAGTGGAATGAAAGAGAATGG - Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1178556222 21:33592693-33592715 TTGTATGAACTGAATGAGGAGGG + Intronic
1178597081 21:33963863-33963885 CAGCATAAAATGAAAGAGGAGGG - Intergenic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1181883074 22:25997016-25997038 CAGTGTGAAGTGAAAGTGTGAGG + Intronic
1181917856 22:26295083-26295105 CAGTTTTAACTGGAAGAGGTAGG - Intronic
1182006641 22:26965815-26965837 CAGTGTGGTATGAAAAAGGAAGG + Intergenic
1183319223 22:37154969-37154991 CAGTGTGAATTGTCTGAGGAGGG - Intronic
1183422960 22:37723057-37723079 CAGTGAGACCTGTAGGAGGAGGG + Intronic
1185095893 22:48806009-48806031 CCCAGTGACCTGAAAGAGGAGGG + Intronic
1185148635 22:49152239-49152261 CCCTGTGAACTGTGAGAGGAGGG + Intergenic
949456947 3:4249006-4249028 CAGTGAGAAGTGAAGGAGAAGGG - Intronic
949753557 3:7382562-7382584 CAGAGTGAACTCAAACATGAGGG - Intronic
949831397 3:8218604-8218626 GAGTGTGGAATGAAAGAGGGTGG - Intergenic
951230917 3:20178945-20178967 CAGTCTGAATTGAAAGAGGCCGG + Intronic
951421466 3:22490892-22490914 CAGTAGGAATTGAAAGATGAAGG - Intergenic
951448880 3:22814081-22814103 CAGTGGCAACAGAAACAGGATGG - Intergenic
951457021 3:22904263-22904285 CAGTGTGGAACGAAAGGGGATGG - Intergenic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
951847134 3:27096750-27096772 CTTTGTGAACTGAAAGAGTGAGG + Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953611668 3:44451943-44451965 CAAAGTGAACTCAAAGAGGCAGG + Intronic
954411656 3:50373824-50373846 AAGTGGGAACTGAGTGAGGATGG + Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
955856768 3:63280466-63280488 CAGTGTGAATAGAAATAGCAAGG - Intronic
957287836 3:78239711-78239733 CACTTTGAACTAAAATAGGAAGG - Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
958484729 3:94690330-94690352 GAGTGTAAACTCAAGGAGGATGG + Intergenic
958684341 3:97373668-97373690 CAGTGTGATTTGAAAGAGAGAGG + Intronic
958988598 3:100813727-100813749 CAGTCAGAGCTGAAAGAAGAGGG + Intronic
959100756 3:102007341-102007363 CAGTGTGGACTGAAAGCTGAGGG - Intergenic
961295968 3:125884602-125884624 TAGTGTGAACTGCATGTGGAAGG + Intergenic
961535033 3:127565442-127565464 CAGTGTGGATTGAAATAAGACGG - Intergenic
961669282 3:128517424-128517446 CAGTGCTAACTGATAGAGCAGGG + Intergenic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
962221612 3:133569091-133569113 ATGTGTGAACTGAAGGATGAGGG - Intergenic
962418411 3:135204797-135204819 CATTTTAAACTGAAAGAGGCTGG - Intronic
962900413 3:139756630-139756652 GAGTGTGATCCCAAAGAGGAAGG - Intergenic
963718292 3:148830117-148830139 CAGAGTGAACTGGAAGCAGATGG - Intronic
965292513 3:166901559-166901581 CAGTCTGAATTAAAAGAGGTTGG - Intergenic
965715890 3:171602652-171602674 CTGTATGAACTGCAAGATGAGGG + Exonic
966476041 3:180348009-180348031 CAGTGAGAACTGAAATGGGAAGG - Intergenic
966962510 3:184954209-184954231 CAGTGTGCACTGAGAGAGCATGG - Intronic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
969287643 4:6214704-6214726 CAGGTTGAATTGAAAAAGGATGG - Intergenic
969965631 4:10992403-10992425 CAGTGGGGAATGAAGGAGGAAGG + Intergenic
971380709 4:26094809-26094831 CAGTGTGGACTGACAGACGATGG - Intergenic
974398914 4:61375560-61375582 CAGTGTGAAAGGAAAGGAGATGG + Intronic
976411680 4:84720578-84720600 TTGTGTGAACTGATAGAGTAAGG - Intronic
977156784 4:93583760-93583782 AAGTGAGAACTGAAGGAGAATGG - Intronic
979659529 4:123237847-123237869 GAGAGTGAACTGAAATAGGGTGG + Intronic
979808489 4:125005088-125005110 CAGTATCAAGTGAAAGAGCAAGG + Intergenic
981011624 4:139931128-139931150 CAGTGTGAAATGAAAATGCAGGG + Intronic
981105086 4:140871806-140871828 GTGTGTGAACTGAAAGAAAAAGG + Intronic
981206454 4:142046594-142046616 TAGAGTGAAAAGAAAGAGGAGGG + Intronic
982014864 4:151143318-151143340 AAGTGTGTTCTGAAAGAGGAAGG + Intronic
982104123 4:151997100-151997122 CATTGGGAATGGAAAGAGGAAGG + Intergenic
982268256 4:153560047-153560069 AAGTGTGAGTTGAAAAAGGAAGG - Intronic
983167369 4:164494644-164494666 AATTATGTACTGAAAGAGGATGG - Intergenic
983276353 4:165622262-165622284 CACTGGGAACTTGAAGAGGAAGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985362698 4:189192588-189192610 TAGTGTGAACTAATAGAGCAAGG + Intergenic
985377634 4:189358563-189358585 CAGTGTCAACAGAAAGCGGCTGG + Intergenic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
986296904 5:6446823-6446845 CAGCGTGAGCTAAAAGAGTAGGG - Intergenic
986317512 5:6600453-6600475 CATTGTGAACTTAAAGAGGCAGG - Intronic
987558737 5:19489850-19489872 AAGTGTTAATTTAAAGAGGAGGG + Intronic
988044274 5:25929622-25929644 CAGTGTGAAATAACCGAGGATGG + Intergenic
988222326 5:28364222-28364244 GAGTGTGAAATGATAGACGATGG + Intergenic
989177493 5:38542822-38542844 CAGTGTGCACTGAAATTTGAAGG - Intronic
991531327 5:67618230-67618252 CAGTGGGATATGTAAGAGGATGG - Intergenic
991975242 5:72178505-72178527 CAGTGGGAGCTGACAGAGCAGGG + Intronic
991985297 5:72279039-72279061 CAATATGAAGTAAAAGAGGATGG - Intronic
992091632 5:73322838-73322860 CAGTGTGCAGTGACTGAGGAAGG + Intergenic
992492421 5:77258341-77258363 CAGAGTGAACTGATGGAGCATGG + Intronic
993168465 5:84385036-84385058 CAGAAGGAGCTGAAAGAGGAGGG - Intergenic
993742209 5:91555534-91555556 GAGTGTGAGCTGAAGGAGGGCGG + Intergenic
993862418 5:93152264-93152286 CAGTGTGAACTAAAAAACTAAGG + Intergenic
995151580 5:108853891-108853913 TAGTCTGAAATGAGAGAGGAAGG + Intronic
995431057 5:112078093-112078115 CAGTGTGGAGGGTAAGAGGAGGG - Intergenic
995578090 5:113562923-113562945 CAGTGTAAACTCAATGAGAATGG + Intronic
995857562 5:116609372-116609394 CAATGTGAACTTATAGCGGAGGG + Intergenic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
997953720 5:138262244-138262266 AAGAGAAAACTGAAAGAGGAAGG + Intronic
999906400 5:156145234-156145256 CAGTAGGAAATGAAAGAGAAAGG - Intronic
1000497319 5:162001184-162001206 CAACCTGGACTGAAAGAGGATGG - Intergenic
1002467616 5:179415516-179415538 CAGTTTTCACTGAATGAGGAAGG + Intergenic
1004558668 6:16726070-16726092 CCCTGTGAACTGTAAGAGGGAGG + Intronic
1005203593 6:23375363-23375385 CACTGTGGACTAATAGAGGAGGG - Intergenic
1005788456 6:29271391-29271413 CAGTCTGAACTGAAGGAGATGGG - Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007404390 6:41625628-41625650 GAGTGTGAACAGAAAGAGGCTGG + Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1010937629 6:81880686-81880708 CAGTGTTGAGTGAAAGAGCAGGG - Intergenic
1011293682 6:85804940-85804962 CACTGTGAACTGAGAGAAGTAGG - Intergenic
1011402338 6:86977193-86977215 CACTGTGAACTACCAGAGGAGGG - Intronic
1012340987 6:98122982-98123004 CATTTTGAAAAGAAAGAGGAAGG - Intergenic
1012783141 6:103589166-103589188 TAGTTTTAACTGAAAGAGGTAGG - Intergenic
1013871182 6:114762811-114762833 CAGCGTTATCTGAAATAGGAGGG - Intergenic
1015374937 6:132499905-132499927 AAGTGTGTACTGAAACGGGAGGG - Intronic
1016139054 6:140585839-140585861 CAGTGAGAGTTGACAGAGGAAGG + Intergenic
1018178553 6:161200100-161200122 GAATGTGCACAGAAAGAGGAAGG + Intronic
1018419564 6:163630353-163630375 CAGTGGGCACTGAAGGAGAAAGG + Intergenic
1019895601 7:3980078-3980100 CAGAGTGAAGTCAAAGAAGATGG + Intronic
1020676813 7:11193191-11193213 CAGTGGGTCCTGAAAAAGGAAGG - Intergenic
1023585420 7:41724885-41724907 CATTTTGAATTGAAACAGGAGGG - Intergenic
1024014314 7:45297080-45297102 CAGTGTGAGCTTAAAGGAGAGGG - Intergenic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029286137 7:99467413-99467435 CAGAATGAACTGAACGAGGGTGG - Intergenic
1030838305 7:114316079-114316101 CAGTAAGAACTGGAACAGGAAGG + Intronic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1031431918 7:121682324-121682346 CAGTGCAAACTGATTGAGGAAGG + Intergenic
1031872755 7:127104604-127104626 AAGTGAGAACTGAAATAGAATGG + Intronic
1031935468 7:127731317-127731339 CAGTTTGTACTTTAAGAGGAGGG + Intronic
1032120997 7:129156418-129156440 CAGTCTGCACTGAAGGAGTAAGG + Intronic
1032254907 7:130289433-130289455 AGGTGTGAACTGTAAGAGGGGGG - Intronic
1033014251 7:137655832-137655854 AAGTGTGAAAGGAAAGAGGATGG + Intronic
1033028205 7:137798296-137798318 TTGTGAGAACTGAAAGAGGAAGG + Intronic
1033099425 7:138457832-138457854 CTGTCTGAACTGGAAGAGAAGGG - Intergenic
1034276718 7:149827069-149827091 CAGTGTGGACAGACAGGGGAGGG - Intergenic
1034746929 7:153530831-153530853 GAGGGTGAGCTGAAAGAGAATGG - Intergenic
1034784358 7:153911570-153911592 CATTGCAAACTGAGAGAGGAAGG - Intronic
1035669995 8:1409734-1409756 CAAATAGAACTGAAAGAGGAAGG + Intergenic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036619087 8:10411286-10411308 CGGTGTGAACACACAGAGGACGG - Intronic
1038845472 8:31225524-31225546 CTGTTAGAACTTAAAGAGGAAGG + Intergenic
1040803785 8:51371664-51371686 TAGTGTGGAATGGAAGAGGATGG + Intronic
1041302387 8:56426365-56426387 GAGTGTGAAGGGAGAGAGGAGGG - Intergenic
1042581836 8:70288240-70288262 CACTATGATGTGAAAGAGGAAGG + Intronic
1044445564 8:92271257-92271279 TAGTGTGTACTAACAGAGGAAGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045802529 8:106117936-106117958 GAGTGTGAACTGAAGCAGGGTGG - Intergenic
1046604151 8:116352100-116352122 CAGTGTGAAATGGAAAAGGTGGG - Intergenic
1048321418 8:133403587-133403609 CAGGGAGAAGTGAAAGGGGAGGG + Intergenic
1048575824 8:135689268-135689290 AAGTGTGGAAGGAAAGAGGAAGG + Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1049412878 8:142481268-142481290 CGGTGTGAGCTGGACGAGGAAGG + Exonic
1051292091 9:15554743-15554765 CACTGCGTAGTGAAAGAGGATGG + Intronic
1051309547 9:15755669-15755691 CATTATGTAGTGAAAGAGGATGG + Intronic
1051662891 9:19442327-19442349 CAATGTGAAGTGAAAAAGGGCGG - Intronic
1052030467 9:23622379-23622401 CAGTGTGCACTGAAATGGCAGGG + Intergenic
1056015616 9:82383200-82383222 CATTTTGAACTAAAATAGGAAGG - Intergenic
1056911718 9:90707049-90707071 CAGTGTGCAGTGCAGGAGGAAGG + Intergenic
1057256947 9:93557523-93557545 CAGTATGAGCTGAAACAAGAAGG + Intronic
1057716076 9:97497429-97497451 AAATGAGAACAGAAAGAGGAAGG + Intergenic
1059433278 9:114262429-114262451 TAGTGTGAACTGCCTGAGGAAGG + Intronic
1059794859 9:117682970-117682992 CAGTGTGAAAGGAAAAGGGAAGG + Intergenic
1185812620 X:3124805-3124827 CAGGGTGAACTTCAAGATGAAGG - Intergenic
1185885973 X:3783148-3783170 TAGTATGAACTGAAATAAGAAGG - Intergenic
1186335056 X:8577491-8577513 CAGAGATAACTGAAATAGGAAGG + Intronic
1186412376 X:9355168-9355190 CAATGAGAGCTGAAACAGGAAGG - Intergenic
1188264078 X:28048906-28048928 CAGTGGTAACTGAAAGTGCATGG - Intergenic
1192461635 X:71322054-71322076 TAGTTTGAAGAGAAAGAGGAAGG + Intergenic
1194020293 X:88681839-88681861 CAGGGTGAGCTGATAGAGCACGG + Intergenic
1199336830 X:146628373-146628395 CAGTGTGGACTGAAAGACACTGG - Intergenic
1201268905 Y:12235450-12235472 CAGGGTGAACTTCAAGATGAAGG + Intergenic
1201303651 Y:12532196-12532218 CAGTGTGGACTCAGAGAGGAAGG + Intergenic