ID: 1106539079

View in Genome Browser
Species Human (GRCh38)
Location 13:30674188-30674210
Sequence GAGGTGCCCAGCGGCCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106539075_1106539079 0 Left 1106539075 13:30674165-30674187 CCGAGGAGGCAGCGGAAGCGGCC No data
Right 1106539079 13:30674188-30674210 GAGGTGCCCAGCGGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106539079 Original CRISPR GAGGTGCCCAGCGGCCGCCG CGG Intergenic
No off target data available for this crispr