ID: 1106539086

View in Genome Browser
Species Human (GRCh38)
Location 13:30674197-30674219
Sequence AGCGGCCGCCGCGGGGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106539075_1106539086 9 Left 1106539075 13:30674165-30674187 CCGAGGAGGCAGCGGAAGCGGCC No data
Right 1106539086 13:30674197-30674219 AGCGGCCGCCGCGGGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106539086 Original CRISPR AGCGGCCGCCGCGGGGGGAG AGG Intergenic
No off target data available for this crispr