ID: 1106539532

View in Genome Browser
Species Human (GRCh38)
Location 13:30677484-30677506
Sequence CAGGCCCTGCTGCAGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106539532_1106539538 -3 Left 1106539532 13:30677484-30677506 CCCCAACACTGCAGCAGGGCCTG No data
Right 1106539538 13:30677504-30677526 CTGGCACATAGCAGGCATGCAGG No data
1106539532_1106539539 -2 Left 1106539532 13:30677484-30677506 CCCCAACACTGCAGCAGGGCCTG No data
Right 1106539539 13:30677505-30677527 TGGCACATAGCAGGCATGCAGGG No data
1106539532_1106539540 20 Left 1106539532 13:30677484-30677506 CCCCAACACTGCAGCAGGGCCTG No data
Right 1106539540 13:30677527-30677549 GACTATGCACTGAATCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106539532 Original CRISPR CAGGCCCTGCTGCAGTGTTG GGG (reversed) Intergenic
No off target data available for this crispr