ID: 1106543380

View in Genome Browser
Species Human (GRCh38)
Location 13:30710107-30710129
Sequence TGTATTCTTAAAATAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 627}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106543376_1106543380 -5 Left 1106543376 13:30710089-30710111 CCTAACCTCTCTCCAAGATGTAT 0: 1
1: 0
2: 0
3: 15
4: 178
Right 1106543380 13:30710107-30710129 TGTATTCTTAAAATAGAAGAGGG 0: 1
1: 0
2: 2
3: 45
4: 627
1106543377_1106543380 -10 Left 1106543377 13:30710094-30710116 CCTCTCTCCAAGATGTATTCTTA 0: 1
1: 0
2: 0
3: 24
4: 251
Right 1106543380 13:30710107-30710129 TGTATTCTTAAAATAGAAGAGGG 0: 1
1: 0
2: 2
3: 45
4: 627
1106543375_1106543380 -4 Left 1106543375 13:30710088-30710110 CCCTAACCTCTCTCCAAGATGTA 0: 1
1: 0
2: 2
3: 12
4: 133
Right 1106543380 13:30710107-30710129 TGTATTCTTAAAATAGAAGAGGG 0: 1
1: 0
2: 2
3: 45
4: 627
1106543374_1106543380 1 Left 1106543374 13:30710083-30710105 CCATACCCTAACCTCTCTCCAAG 0: 1
1: 0
2: 1
3: 19
4: 231
Right 1106543380 13:30710107-30710129 TGTATTCTTAAAATAGAAGAGGG 0: 1
1: 0
2: 2
3: 45
4: 627

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106543380 Original CRISPR TGTATTCTTAAAATAGAAGA GGG Intergenic
900229622 1:1550002-1550024 TGTATTTTTAGTAGAGAAGACGG - Intronic
901337465 1:8463596-8463618 TGTATTTTTAAAATTCCAGAGGG + Intronic
901734085 1:11301226-11301248 TGTATTTTTAAAATAGAGACAGG + Intergenic
901962662 1:12839749-12839771 CGTATTCTTCATAAAGAAGAGGG - Intergenic
902224131 1:14985827-14985849 TGTATTCTTAGTAGAGATGAGGG - Intronic
902341752 1:15787992-15788014 TGTATTATAAAAATAGAGGCCGG + Intergenic
904725307 1:32542401-32542423 TGTATTTTTAGTAAAGAAGATGG - Intronic
904940383 1:34161997-34162019 TGTATTTTTAATAGAGAAGGGGG - Intronic
904966056 1:34373604-34373626 TTTCTTTTTAAAAGAGAAGAAGG - Intergenic
907166741 1:52418622-52418644 CCTATTCTTTAATTAGAAGAAGG + Exonic
908087041 1:60646327-60646349 TGAATTTTTAGAATAGCAGAAGG - Intergenic
909197224 1:72642730-72642752 TGTATTCTTAATATAAAGTATGG - Intergenic
909732083 1:78905095-78905117 TATGTTCTTAATATAGAGGAGGG + Intronic
909798007 1:79768169-79768191 TGAATTATTACAATGGAAGAAGG + Intergenic
909954342 1:81759814-81759836 TGTATTCAAGAAATAGAAAATGG + Intronic
909981440 1:82106405-82106427 TATATTCTCAAAATTGATGAAGG - Intergenic
910031019 1:82723454-82723476 ATTATTATTAAAATAGAAAATGG + Intergenic
910184254 1:84519237-84519259 TGTATTTTTAAAATAGCTAATGG + Intergenic
910648157 1:89535609-89535631 TACATTCTTAAAATGGATGACGG - Intronic
910967299 1:92820363-92820385 TGTATTTTTAAAATATCAGTCGG + Intergenic
910988702 1:93031858-93031880 AGTATTCTTAATGTAGAGGAAGG + Intergenic
911021035 1:93387891-93387913 TGTATTTTTTAAATGGATGATGG + Intergenic
911353803 1:96791290-96791312 TGTTTTCTTAAAATATATGTAGG + Intronic
913685435 1:121227436-121227458 TGCATTCTTAAGTTAGCAGAAGG + Intronic
913984779 1:143554991-143555013 TTCATTCTTACATTAGAAGAAGG + Intergenic
914037282 1:144015040-144015062 TGCATTCTTAAGTTAGCAGAAGG + Intergenic
914152173 1:145052892-145052914 TGCATTCTTAAGTTAGCAGAAGG - Intronic
916386445 1:164277267-164277289 TGTAAACTAAAAATAGAATATGG + Intergenic
917010038 1:170460738-170460760 TGTATTATTGAAATAACAGATGG + Intergenic
917570834 1:176263536-176263558 TTTAGTCTTAAAATAGATAAAGG + Intergenic
918509538 1:185295706-185295728 AGAATTCTTAAAATTGAAGTAGG - Intergenic
918594644 1:186279009-186279031 TGAATTCTGAAAATACTAGATGG + Intergenic
918684038 1:187392691-187392713 TATTTTTTTAAAATATAAGATGG - Intergenic
919024804 1:192153642-192153664 AGAATTCTTAATATAGAAAAAGG - Intergenic
919156196 1:193768900-193768922 TACATTATTAAAATAGAATATGG - Intergenic
919195881 1:194285524-194285546 TTTCTTCTTAAAATAAAAGCAGG - Intergenic
919207196 1:194432719-194432741 TATATTTTTAAAATAGTGGAAGG - Intergenic
919578837 1:199345736-199345758 TGAAATGTTAAAAAAGAAGATGG - Intergenic
920018156 1:202930323-202930345 TTTATTCACAAAATAAAAGATGG + Intergenic
920027091 1:203006928-203006950 TGAATTCTCAAAATAGGAGAAGG - Intergenic
920388510 1:205584393-205584415 TGTATTTTTAAAGTAGAGAAGGG + Intronic
920447545 1:206030338-206030360 TTTGTTCTTACAATAAAAGAAGG - Intergenic
920472753 1:206245994-206246016 TGCATTCTTAAGTTAGCAGAAGG + Intronic
920620346 1:207540167-207540189 TGGATTCTTCAAATATGAGAAGG - Intronic
920622128 1:207558724-207558746 TGGATTCTTCAAATATGAGAAGG - Intronic
920636374 1:207708364-207708386 TGGATTCTTCAAATATCAGAAGG - Intronic
921240854 1:213180174-213180196 TGTAGTCTTCAAATAGTTGAGGG + Intronic
921392675 1:214632398-214632420 TGTATTCTTAAACAATAAAATGG - Intronic
921410425 1:214830514-214830536 TGTGTTCTTAAATCAGAAAAGGG + Intergenic
921460794 1:215424041-215424063 TCAATTTTTAAAATAAAAGATGG - Intergenic
921651618 1:217685656-217685678 TGTATTCCTAAAATAAATGATGG - Intronic
921664038 1:217845273-217845295 AGTGCTCTTAAAATAGGAGAGGG - Intronic
922737218 1:227993573-227993595 TGTATTCTTACAATATAGTAAGG - Intergenic
923573334 1:235136177-235136199 TGTGTGGTTAAATTAGAAGATGG - Intronic
923599616 1:235390842-235390864 TTTATTCTGAAGATGGAAGAGGG + Intronic
923865271 1:237932808-237932830 TGTCTACTTAAACTAGAAGTAGG + Intergenic
924294369 1:242570523-242570545 TGTATTCTCAACATAGCAGCTGG + Intergenic
924298035 1:242608542-242608564 GGTATTCTGATACTAGAAGATGG - Intergenic
924464058 1:244284468-244284490 TGGACTTTTAATATAGAAGAAGG - Intergenic
924592531 1:245417306-245417328 TTTTTTCTTAAATTAGAAGAGGG + Intronic
1063259434 10:4369096-4369118 CCTATTCTTAAAATAAAAGTTGG - Intergenic
1063452098 10:6156916-6156938 TGTATTTTTAGTAGAGAAGAGGG - Intronic
1064499307 10:15951655-15951677 TGAATTCTTACAATACCAGATGG + Intergenic
1065837886 10:29675653-29675675 TTTATTCTTAGAACAGATGAGGG - Intronic
1066024771 10:31344593-31344615 TTAATTGTTAAAATATAAGAAGG + Intronic
1066531245 10:36342202-36342224 TGTATTGTTCCAATAGAAGGTGG - Intergenic
1067200242 10:44163882-44163904 TGTTTACTTAACATAAAAGAAGG - Intergenic
1068054331 10:51992399-51992421 TGTATTGTAAAAATGGAAGAGGG + Intronic
1068233451 10:54201194-54201216 TGTATTGTGAAATGAGAAGATGG - Intronic
1068260070 10:54568779-54568801 TATATATTTAAAATAGAAAAAGG - Intronic
1068293874 10:55041702-55041724 TATATTCTTGAATAAGAAGATGG - Intronic
1068474200 10:57505100-57505122 TGTACACTTAAAATATAAGTGGG - Intergenic
1068584425 10:58780792-58780814 AGTATTCTTACAATAGAGTAAGG + Intronic
1068861989 10:61856612-61856634 TGTATCTCTAAAATATAAGAAGG + Intergenic
1070447367 10:76520411-76520433 CGTCATCTTGAAATAGAAGAGGG - Intronic
1071014545 10:80979720-80979742 TATATTCATATAATAGAATATGG - Intergenic
1071138330 10:82478014-82478036 TGTATTCTTCAAATCCCAGAGGG - Intronic
1071153254 10:82660919-82660941 TATGTTCTAAAAATGGAAGAGGG - Intronic
1071210393 10:83335346-83335368 AGTATTCATATAATAGAACAAGG - Intergenic
1072022380 10:91414963-91414985 TGTATAGTTAAACTAGAGGAGGG + Intronic
1072387731 10:94948787-94948809 TATAATCTTGAAATATAAGATGG - Intronic
1072432522 10:95385821-95385843 TATCTTCTGAAAATAGAACAGGG + Intronic
1072553741 10:96498551-96498573 GGTTCTCTTAAAATGGAAGAAGG - Intronic
1073601282 10:104848324-104848346 TGCTTTTTTAAAATAGAAAATGG + Intronic
1074695362 10:116045655-116045677 TTAATTCTTAAGATAGAAGCTGG + Intergenic
1075335486 10:121606234-121606256 TTTATTTTTAAGATAGAAGGGGG - Intergenic
1075469778 10:122679306-122679328 TGTCTTCTTGATATAGAAGTGGG + Intergenic
1075507515 10:123037618-123037640 TCTATTTTAAAAATATAAGAAGG + Intronic
1075690528 10:124390989-124391011 TGGATTCTTAAAATACCAGCAGG - Intergenic
1076267583 10:129120700-129120722 TGTATTATTCAAAGAGAGGAGGG + Intergenic
1078332552 11:10437387-10437409 TGTGTCCAGAAAATAGAAGAAGG - Intronic
1078499511 11:11856428-11856450 TTTATTCTTAAAAAACAAAAAGG - Intronic
1078601838 11:12739309-12739331 TGTACACTTAAAAATGAAGATGG - Intronic
1078836285 11:15033825-15033847 TGCAATCTCAAAATAAAAGACGG + Intronic
1078837031 11:15040843-15040865 TGTATTTTGAAAATGGAGGAAGG - Intronic
1079200365 11:18372037-18372059 TTTTTTCTTTAAATAGAAGTTGG + Intergenic
1079296238 11:19237152-19237174 TTCATTCTTATATTAGAAGAGGG + Intronic
1080174625 11:29347221-29347243 TGTATTCTCAGAATACAAGTAGG - Intergenic
1080384549 11:31803497-31803519 TGTTTGGTTAGAATAGAAGAAGG + Intronic
1080630850 11:34074197-34074219 TGCTTTTTTAAAATAGAAGCAGG + Intronic
1080882756 11:36338135-36338157 TGTCTTGTTAAAAAGGAAGAAGG + Intronic
1080992020 11:37547929-37547951 TAGATTTTTAACATAGAAGAGGG - Intergenic
1081283714 11:41243461-41243483 TGTCTTCTTAACATTGAGGAAGG - Intronic
1082627801 11:55504810-55504832 TTTATTCTACAACTAGAAGAGGG + Intergenic
1082691573 11:56311122-56311144 TTTATTCTTCAAATAAAAAATGG - Intergenic
1082915162 11:58426402-58426424 TTTATTCAAATAATAGAAGATGG - Intergenic
1083189310 11:61038074-61038096 TATATTTTTAAAATGGATGATGG - Intergenic
1083738222 11:64693909-64693931 TGGATTTTGAAAATAGAAAATGG + Intronic
1084901150 11:72310920-72310942 TGCATTCTTAGAAAAGAAGCGGG - Intronic
1085867699 11:80314499-80314521 TGTATTTTTAAAACGGATGATGG + Intergenic
1086416734 11:86596417-86596439 TGTACTTTGAAAATAGAGGAAGG - Intronic
1087184239 11:95170026-95170048 GGTATTTTTAAAATAAAAGATGG - Exonic
1087266267 11:96065020-96065042 TGTGTTCTTAAAAAACTAGAAGG + Intronic
1087291978 11:96330038-96330060 TCTACCCTTAAAATAGAAAAGGG - Intronic
1087790093 11:102396350-102396372 TTTATTCTAAAAATAGAACTTGG + Exonic
1087834583 11:102859925-102859947 TGTGTTTTTAAAATATGAGAGGG - Intergenic
1089805331 11:121082665-121082687 TTTCTTCTTAAAATAGCTGATGG - Intronic
1090641362 11:128731686-128731708 TGAAATCTTAAAATAGGAGACGG - Intronic
1093023459 12:14223418-14223440 TGTGTTATTAAGATAGAGGAAGG - Intergenic
1093232936 12:16570186-16570208 TGTCTACTTAAAATTGAATAGGG + Intronic
1093295613 12:17386987-17387009 CGTATTCTTAAAAAATAAAAGGG - Intergenic
1093766943 12:22974904-22974926 TTTCTTCTTAAAATATAAGTGGG - Intergenic
1093923869 12:24889817-24889839 ATTATTTTTAAAATATAAGATGG - Intronic
1093963201 12:25298348-25298370 TGTATTCTTCAAAAATAACAAGG - Intergenic
1093986151 12:25536619-25536641 TGTAGTATCAAAAGAGAAGAAGG + Intronic
1098250429 12:68563715-68563737 TGTATTTTTAATAGAGAAGGGGG + Intergenic
1098440786 12:70515181-70515203 TTTATTCTTAAAGAAAAAGAGGG - Intergenic
1098538984 12:71630190-71630212 TGTTTTCAAAAAATAGAGGAAGG - Intronic
1098603197 12:72358429-72358451 TGTATTCTTACAATAAAGCAAGG - Intronic
1099083916 12:78221475-78221497 ATTATTCTTCAAATAGAACATGG + Intergenic
1099723613 12:86396909-86396931 TGTATTAAGAAAAAAGAAGAAGG - Intronic
1099850241 12:88086267-88086289 TGTATATTTAAAATATAAGAGGG - Intronic
1099906540 12:88778029-88778051 TGTCCTCTTAAAAGAGGAGATGG - Intergenic
1100930306 12:99600961-99600983 TGTATTTTGAAAGTAGAAGGAGG - Intronic
1101219365 12:102620979-102621001 TACATTTTTAAAATAGAAAATGG - Intergenic
1101303585 12:103505105-103505127 TGTGTTCCTTAAAAAGAAGATGG + Intergenic
1102312148 12:111853922-111853944 TTTATTCTTAATATAGTATATGG + Intronic
1103314161 12:120038957-120038979 TAGATTCTTAAAATACATGAAGG + Intronic
1103377328 12:120467770-120467792 TGCATTCGAAAAACAGAAGAGGG + Intronic
1103673637 12:122638846-122638868 TATATTCTTAAAACATAAGCCGG + Intergenic
1103810285 12:123608010-123608032 TGAATTTTTTAAAAAGAAGATGG + Intronic
1104003803 12:124878133-124878155 TTTATTTTTAAAATAGAGGCAGG - Intronic
1104185400 12:126425630-126425652 TGAATTGTTAAAATCTAAGAAGG + Intergenic
1104201155 12:126590676-126590698 ACTATTCTTAAAATAGATGAAGG + Intergenic
1104509160 12:129360486-129360508 TGGGTTCTTAAAAGAGACGAGGG + Intronic
1105329462 13:19401919-19401941 TGTATTTTTAAAATAAAAATGGG + Intergenic
1105743050 13:23348940-23348962 TGTATAATTAGAACAGAAGAGGG + Intronic
1105806846 13:23956841-23956863 TGTGTTCTTAGAATGGAAAATGG + Intergenic
1105839388 13:24240608-24240630 TGAAGTCTTAGAATACAAGATGG - Intronic
1105897997 13:24733681-24733703 TCTATTCTTAAAATGGGTGAAGG + Intergenic
1106543380 13:30710107-30710129 TGTATTCTTAAAATAGAAGAGGG + Intergenic
1106623441 13:31393952-31393974 TGTATTCTTAATAGAGATGGGGG + Intergenic
1106665180 13:31844430-31844452 TGTATACTGACAATAGAAGTAGG + Intergenic
1106753115 13:32795251-32795273 TGTATTTTTAAAATAGAAACGGG + Intergenic
1107386823 13:39919322-39919344 TGTACACTTAAAATTTAAGAGGG - Intergenic
1107607360 13:42072954-42072976 TATATTCTAATATTAGAAGATGG - Intronic
1107745021 13:43495094-43495116 TGTATTCATAAAACATAGGAAGG - Intronic
1108135250 13:47350046-47350068 TTTATTTTTTAAAAAGAAGATGG - Intergenic
1108675903 13:52737816-52737838 TGTATTTTAAATATAGAAGCTGG - Intronic
1108728342 13:53205140-53205162 TGTATTCAAAAAACACAAGAAGG - Intergenic
1108854916 13:54781140-54781162 TGTCTTCTCACAATAGAGGAGGG - Intergenic
1108899778 13:55387613-55387635 TCTATTTTTAAAATAAAATATGG - Intergenic
1109005932 13:56876167-56876189 TGTATTCACAAAAGAAAAGATGG + Intergenic
1109130606 13:58579749-58579771 TGTATTCATAAATCAGAACACGG + Intergenic
1109529749 13:63626236-63626258 TGTGTTATTAAATTAGTAGAAGG - Intergenic
1109921866 13:69074455-69074477 TGTATTCTTATAATAAACTAGGG + Intergenic
1109977938 13:69866001-69866023 TCTATTATAAAAATAAAAGATGG - Intronic
1109999950 13:70183717-70183739 TGTATTCTCAGAATTGAACAAGG - Intergenic
1110201758 13:72858866-72858888 TGTTTTCATAAAAGGGAAGAAGG + Intronic
1110262271 13:73499034-73499056 TTTTTTCTTAAGTTAGAAGAAGG - Intergenic
1110483391 13:76010229-76010251 TGAATTCTAAAAATAGAAAAAGG + Intergenic
1110494494 13:76150340-76150362 TGTATTCTTTTAACAGAAAATGG + Intergenic
1110915365 13:81014338-81014360 GGTCTTTTGAAAATAGAAGATGG + Intergenic
1111002412 13:82203028-82203050 TGTATGGTTAAAATATAAAATGG + Intergenic
1111252804 13:85625816-85625838 TGTATTCATAAAGAAGAAAATGG + Intergenic
1111607512 13:90560392-90560414 TGTATACTGAGAATAAAAGAAGG + Intergenic
1111758013 13:92422885-92422907 AGAATTCTCAAAATAGAAGTAGG - Intronic
1112311957 13:98326341-98326363 TGTATGCTTAAAAACGATGAAGG - Intronic
1112747829 13:102547415-102547437 TTTTTTCTTAAGATGGAAGAAGG - Intergenic
1112791983 13:103013331-103013353 TGTCTTTTTCAAATAGAAGAAGG + Intergenic
1113011141 13:105767591-105767613 TGCATTCTTAAAGGAAAAGATGG - Intergenic
1113048596 13:106183740-106183762 TGGAGCATTAAAATAGAAGACGG - Intergenic
1113502820 13:110791593-110791615 TGTATTATTGAAATAGCAGAGGG - Intergenic
1114161030 14:20167762-20167784 TGTTGTCTTAAAATCTAAGAGGG + Intergenic
1114862297 14:26539131-26539153 TGTATTCTTGTAAAAGAAGAGGG - Intronic
1115113085 14:29847819-29847841 TGTATGCTTTAAATAGAAAGTGG - Intronic
1115377494 14:32693808-32693830 TGTATGATTAAAATATAGGAGGG + Intronic
1115584057 14:34792210-34792232 TGTATTTTTAAAATAGAGACGGG - Intronic
1116182327 14:41550913-41550935 CGTGTTCTTAAAATAAATGATGG + Intergenic
1116333672 14:43628887-43628909 TGTATTCTTAAAATTGCTAAGGG + Intergenic
1116639073 14:47437686-47437708 CATATTCTTAAATTAGGAGATGG - Intronic
1117263537 14:54061907-54061929 TGTATTCTTACAAAAAAGGAAGG - Intergenic
1117433967 14:55698929-55698951 AGTACTCTGAAAATGGAAGATGG + Intronic
1117694333 14:58343653-58343675 TGTATTTTTAATAGAGAAGGGGG - Intronic
1118080273 14:62350723-62350745 TGTATACTTTAAATTTAAGAGGG - Intergenic
1118118714 14:62811253-62811275 TGTTTTCTTAAAATATCTGATGG + Intronic
1119289476 14:73483687-73483709 TTTATTTTTAAAATGGATGATGG + Intronic
1119975858 14:79023190-79023212 TGTCTTCTGAAAATGGAAGATGG + Intronic
1120285405 14:82494211-82494233 TTTATTCTGAAAATAAAATAAGG - Intergenic
1120359549 14:83480932-83480954 TGTATTCTTAAAATAGTGTTTGG - Intergenic
1120708818 14:87772214-87772236 TGTAGTCCTAAAATATTAGATGG + Intergenic
1121754274 14:96390483-96390505 AGTATTTTTTAAAAAGAAGAAGG + Intergenic
1124329611 15:28798705-28798727 TTTATTCTTAAAAAAAAAAAGGG - Intergenic
1124330205 15:28806044-28806066 TGAATTTTTAAAACAGAAAACGG - Intergenic
1124838014 15:33214291-33214313 TGAAACCTTAAAATAGAACACGG - Intergenic
1125821380 15:42635095-42635117 CTCATTCTTAAAACAGAAGAAGG - Intronic
1125992605 15:44124345-44124367 AGTATCCTCAAAATAAAAGAAGG + Intronic
1126546073 15:49875972-49875994 TTTTTTCTTCAAATACAAGAAGG + Intronic
1126598107 15:50401691-50401713 TGTATTTTTAAAATAAAAACAGG - Intergenic
1126600571 15:50423781-50423803 TGTATTCTTAATAGAGACGGGGG + Intergenic
1126732452 15:51698128-51698150 TATCTTCTTAAAATAGAGGTAGG + Intronic
1127211158 15:56776305-56776327 TTTATTCTGAAATCAGAAGATGG - Intronic
1127421430 15:58810213-58810235 CATATTCTGAAAATAGAAAAGGG - Exonic
1128121463 15:65150934-65150956 TGTTTTTTTAAAATAAAAAATGG + Intronic
1130435473 15:83894526-83894548 TGTATTTTTTAAATGAAAGATGG - Intronic
1130850073 15:87784296-87784318 TGAATTCTTGAAATAAAGGAGGG - Intergenic
1131289143 15:91090132-91090154 AATATTATTAAAATAGAAAAAGG + Intergenic
1131558101 15:93416641-93416663 TGTATTCTCAGAAAAGAAAAAGG + Intergenic
1131573957 15:93567627-93567649 TGTAAACTTTAAATAGATGATGG - Intergenic
1132103930 15:99049430-99049452 TGTATTGTTAAAAATGAAGTGGG - Intergenic
1132427308 15:101729253-101729275 TTTATTCTGAAGATACAAGAAGG + Intergenic
1132487571 16:202975-202997 TGTATTTTTAGTAGAGAAGACGG - Intronic
1132519394 16:380537-380559 TGTATTCTTAGTAGAGAAGGGGG + Intronic
1133169720 16:3974535-3974557 TGCATTCTTAGAATAGAAAGTGG - Intronic
1133510886 16:6456235-6456257 TGTATTTTTAGAAAAGAACATGG + Intronic
1133690970 16:8214617-8214639 TGTATGCTTAAAAAATCAGAAGG + Intergenic
1133812689 16:9173332-9173354 TGTATTATTAAAAAAGAAAATGG + Intergenic
1135708075 16:24692265-24692287 TGTAATTTTAAAATACAAAAGGG + Intergenic
1136654592 16:31702423-31702445 GGCATTCTTGAAATAGGAGATGG + Intergenic
1136670977 16:31857097-31857119 AGTATTCAAAAAATAGAAGGGGG + Intergenic
1137879582 16:52032202-52032224 TTTATTCGTAAAATAGAAGCTGG + Intronic
1138115894 16:54360252-54360274 AGTATACTTAAAATAAAAAAGGG - Intergenic
1138852863 16:60651147-60651169 TGTATTTTAATAATAGAAGAGGG + Intergenic
1140283102 16:73573487-73573509 CATATGCTTAGAATAGAAGATGG + Intergenic
1140322395 16:73965938-73965960 GGACTTGTTAAAATAGAAGAAGG - Intergenic
1140519407 16:75568389-75568411 TGGATTCAGAAAATAGAACAAGG + Intronic
1141045120 16:80709074-80709096 TGTATTTTCAAAACAGGAGAAGG - Intronic
1141118698 16:81334010-81334032 TGTTTTCTGAAAAGAGAACATGG - Intronic
1141344314 16:83231200-83231222 TGAATTCTTCATAGAGAAGAGGG - Intronic
1141821095 16:86446472-86446494 TGAGTTGTTAAAAGAGAAGAGGG - Intergenic
1144118650 17:12127675-12127697 TCTATTATTAAAACACAAGAAGG + Intronic
1144607779 17:16683175-16683197 TGTATTCTTGAAAATCAAGAAGG + Intergenic
1145024239 17:19455837-19455859 TGTATTTTTAAAACAGAGGCGGG - Intergenic
1145967256 17:28928517-28928539 TGTATTATAAAAATACAAGGAGG - Intronic
1146198480 17:30833455-30833477 TGTATTCTACAAATGAAAGAAGG + Intronic
1146230394 17:31103017-31103039 TGTATTTTTAAAAGAGACAAGGG + Intronic
1146389853 17:32411932-32411954 TCTATTATTAAAATAAAAGTTGG - Intergenic
1146434680 17:32833482-32833504 TTTATTCTTAAAACAGCAGCCGG + Intronic
1146776297 17:35620362-35620384 TGTAATCTTGAACTAGCAGATGG - Intronic
1149026566 17:52034486-52034508 TTATTTCTTAAAAGAGAAGAGGG + Intronic
1150035294 17:61789746-61789768 TATATTGTTAAATTAAAAGAGGG + Intronic
1150096418 17:62380173-62380195 TGTATTTTTAATAGAGATGAGGG + Intronic
1150230549 17:63547491-63547513 TGTGTTTTTAAAATAGATGGTGG - Intronic
1152810646 17:82380420-82380442 TGTATTCTAAAATGAGAAGCAGG + Intergenic
1153650531 18:7236004-7236026 TGTTTTCTTGAAATATAGGAAGG - Intergenic
1153676800 18:7462972-7462994 TGTCTTCTTACATTGGAAGAAGG + Intergenic
1154341297 18:13504730-13504752 TGTATTCTAAAAATACAGAATGG - Intronic
1155793360 18:30001991-30002013 TGTATTTTTAATATAGATTAAGG + Intergenic
1156547044 18:37973894-37973916 TGTGTACTTGAAAGAGAAGATGG - Intergenic
1156630756 18:38965424-38965446 TCTATTCCTTCAATAGAAGATGG - Intergenic
1156659105 18:39325778-39325800 TACATTCTTGAAATTGAAGAGGG + Intergenic
1156737898 18:40284642-40284664 TGTTTACTAAAAATAAAAGAAGG + Intergenic
1157033911 18:43947948-43947970 TGAATTAATAAAATAGAGGATGG + Intergenic
1157624945 18:49043429-49043451 TCTTTTCTTAAAAAAGAATATGG - Exonic
1157826802 18:50819696-50819718 TGAATTCCTAACATACAAGAAGG + Exonic
1157887923 18:51386428-51386450 TTTATTGTTAGAATAGGAGAAGG + Intergenic
1158194311 18:54867189-54867211 TGTTTTATTAAAATAAAAGTGGG + Intronic
1158252221 18:55501831-55501853 TGTCTTCTTTCAACAGAAGAGGG + Intronic
1158649222 18:59272109-59272131 TCTAAACTCAAAATAGAAGATGG - Intronic
1158818616 18:61132539-61132561 TGTATTGTTAAACTTCAAGAGGG - Intergenic
1158916292 18:62134459-62134481 TGTCTTCATGAAATAGAATATGG - Intronic
1159518345 18:69487308-69487330 TGGATTTATAAAATAGAAAAAGG - Intronic
1159542062 18:69790534-69790556 TATATTCTTAAAATAGTATATGG + Intronic
1159636926 18:70816178-70816200 TTTATTTTTAAAAGAAAAGATGG + Intergenic
1159987436 18:74860003-74860025 TGTCTTATTAAAAGAGAATATGG + Intronic
1161292493 19:3502517-3502539 TGTTGTCTTAAAATAGAAGTTGG - Intergenic
1162122385 19:8479403-8479425 TGTATTCTTCAAATTTATGAAGG + Intronic
1162763025 19:12899709-12899731 TGTGTTCCTTAAAAAGAAGATGG + Exonic
1163918919 19:20269563-20269585 TGTATTTTTAGTATAGATGAGGG - Intergenic
1164049591 19:21573288-21573310 TTTATTTTTAAAAGAGTAGAGGG + Intergenic
1164049747 19:21574890-21574912 TTTATTCTTAAAAGATATGAAGG - Intergenic
1164894819 19:31864949-31864971 TGTGTTCATAAACTGGAAGAAGG + Intergenic
1168519597 19:57038069-57038091 TGTGTTTTTAAAAGAGGAGAAGG + Intergenic
1168550536 19:57289828-57289850 TGTATTTTTAAAATAGAGATGGG - Intronic
925489968 2:4380566-4380588 TGTGTTTTTAAAATAAAAGCAGG + Intergenic
925529989 2:4849050-4849072 TGTAGTCTTAGAATTGGAGATGG + Intergenic
926397350 2:12457330-12457352 TGGATTCTGGAAATAGCAGATGG + Intergenic
926467537 2:13209493-13209515 TGTTTTCTTTAAAAAGGAGATGG + Intergenic
926536235 2:14116283-14116305 TGTGTTGTGAAAAGAGAAGAGGG + Intergenic
926552921 2:14321639-14321661 TGTATTCTCGAAAGGGAAGAAGG - Intergenic
926711866 2:15888439-15888461 TGTATTTTTTAAATAGAAACAGG - Intergenic
926760349 2:16273177-16273199 TGTCTGCTCAAATTAGAAGATGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927125608 2:20010525-20010547 TGTAATTATAAAGTAGAAGAGGG + Intronic
927163491 2:20292756-20292778 TGTATTTTTAATAGAGAACAGGG - Intronic
928222002 2:29411471-29411493 TTTTTTCTTAAAAAAGAAAAAGG - Intronic
928706665 2:33957125-33957147 TGTATTCATGAAATAGGACAAGG - Intergenic
928746050 2:34417093-34417115 TGTCTTGTTAAAAAAAAAGAGGG + Intergenic
929250163 2:39744907-39744929 TGTATTTTTAAAAGAGAATTTGG + Intronic
929481911 2:42316794-42316816 AGTATTCTTTAAATTGAACAAGG + Intronic
929712246 2:44277278-44277300 TGTATTTTTAATAGAGACGAGGG + Intronic
929816468 2:45236823-45236845 TGTTTTCTTAAAAAAAATGACGG + Intergenic
930207260 2:48600394-48600416 TACATTCTTTAAACAGAAGAGGG + Intronic
930444604 2:51454112-51454134 TGTAATCTTGCAATAAAAGAAGG + Intergenic
930550510 2:52829078-52829100 TTACTTCCTAAAATAGAAGAAGG + Intergenic
930573446 2:53115368-53115390 TGCATTTTGCAAATAGAAGATGG - Intergenic
930923181 2:56782565-56782587 TGTATTTTTAAAATAGAGACTGG + Intergenic
931361325 2:61580264-61580286 TGACTTCCTAAAATAGAAGTAGG - Intergenic
932516506 2:72356150-72356172 TGTATTTTAAAAATAAAAGTTGG - Intronic
932528765 2:72502753-72502775 TGTAGTAATAAAATAAAAGAAGG - Intronic
932553188 2:72793794-72793816 TATAGACTTGAAATAGAAGAGGG + Intronic
933287438 2:80399726-80399748 TCTTTGCTAAAAATAGAAGAAGG - Intronic
933363818 2:81323509-81323531 GGCATTCTTAAGATAGAAGAAGG - Intergenic
933386794 2:81621175-81621197 AACATTCTTAAAATACAAGATGG + Intergenic
933408556 2:81895157-81895179 TGTTTTGTTAAGATAGAAAATGG + Intergenic
933936993 2:87214339-87214361 TGCTTTCTTAAAATAAGAGAGGG - Intergenic
936356149 2:111751485-111751507 TGCTTTCTTAAAATAAGAGAGGG + Intergenic
936762852 2:115806787-115806809 TGTATCTTTAAAAAAGAAGCAGG - Intronic
936985007 2:118300768-118300790 TGTATTCTTACAATATGATAAGG + Intergenic
937941259 2:127287912-127287934 TGTATTTTTATAATAAAGGAAGG - Intronic
938414201 2:131091035-131091057 TATATTTTTAAAAAAGAAGCTGG + Intronic
938418278 2:131122779-131122801 TGTAGTCTTAGAATAGACAAAGG + Intronic
938664066 2:133515852-133515874 GGAATTGGTAAAATAGAAGAAGG - Intronic
938679682 2:133676887-133676909 GATAATTTTAAAATAGAAGATGG - Intergenic
939033878 2:137108334-137108356 ACTATTCTTAAAATAGAACCAGG - Intronic
939094438 2:137818137-137818159 TGTATTCTTCAAACAGATGGGGG - Intergenic
939152875 2:138493932-138493954 AGTTTTTTTAAAATAGAAAATGG + Intergenic
939159673 2:138572612-138572634 TTTATTCTTACAAAAGAAGGTGG + Exonic
939436776 2:142187035-142187057 TGAAATCTTAAAAAAAAAGAGGG - Intergenic
939843080 2:147212228-147212250 GATATTCTTGAGATAGAAGAGGG - Intergenic
939957452 2:148538945-148538967 TGAATTTTTAAGATAGAACAAGG + Intergenic
939993668 2:148900310-148900332 TGTAAGCTTTAAATAGAAAATGG - Intronic
940331143 2:152476075-152476097 TGTATTCATAAAAGAGGAGAAGG - Intronic
940419094 2:153457485-153457507 TTTATTTTTAAAAGAGGAGATGG - Intergenic
940498263 2:154461590-154461612 TGTAATCTTCAAATAGAATAAGG + Intergenic
940839222 2:158559730-158559752 TGTTTTCATAAAATAGACAAAGG + Intronic
941163793 2:162063842-162063864 CATATTCTTAAAAAATAAGAAGG - Intronic
941379263 2:164772198-164772220 TTTATTTTTAAAATAAAACATGG + Intronic
941586759 2:167368906-167368928 AGTATTCCTAAGATAGTAGATGG + Intergenic
942100960 2:172583079-172583101 TGTATTCTATAAATACATGAAGG - Intronic
942687894 2:178553150-178553172 TATATTCTCACAATAGAAAATGG - Exonic
942961191 2:181831308-181831330 TTTATTCTGAGAGTAGAAGATGG - Intergenic
943592609 2:189816965-189816987 TTTATTTTTAAAAAAAAAGATGG + Intronic
943868462 2:192959774-192959796 TGTTTTCTTAAAATAGAGATGGG + Intergenic
943971971 2:194421802-194421824 TGGAATCCTAAAATAGAACAAGG + Intergenic
944015489 2:195031455-195031477 TGTATTCTTAAGGGAGAAAAGGG + Intergenic
944637376 2:201687806-201687828 TCCATTCTTCAAATAGAAAATGG + Intronic
944865563 2:203857775-203857797 TGTGCTCTTAAAATATAAGCAGG - Intergenic
944959067 2:204848740-204848762 TGTATTCTTAAACTAAAAGCTGG + Intronic
945275410 2:207982909-207982931 TGTATTCTTACAATAGAGTAAGG - Intronic
946250761 2:218410537-218410559 TTTATTTTTAAAATTGAATAAGG - Intergenic
946620588 2:221558176-221558198 TGTATTTTTAAAATAATAGATGG - Intronic
947220693 2:227789093-227789115 TATATTCTAGAAATGGAAGAGGG - Intergenic
947280596 2:228448965-228448987 TTTATTCTGAAAATGGAAAAAGG - Intergenic
947620767 2:231589458-231589480 TGATTTCCTAAAATAGAATAAGG + Intergenic
947883088 2:233537980-233538002 TGTAATGGTAAAATATAAGAAGG + Intronic
1168780556 20:485732-485754 TCTTTTCTTAAAAAAGAGGAGGG + Intronic
1168884641 20:1239648-1239670 TGAATTATTAAAATAGTATATGG + Intronic
1169314046 20:4573273-4573295 TGGGTTCTTAAAAGTGAAGAGGG - Intergenic
1169505308 20:6204094-6204116 ACTATTCCAAAAATAGAAGATGG - Intergenic
1169538719 20:6576736-6576758 TGTTTTCTTAAAATTGATGCAGG + Intergenic
1169552239 20:6713059-6713081 TGTATTCTTAATAGAGACGGAGG + Intergenic
1169706135 20:8507071-8507093 TGTATTCTTACAATAAAGTAAGG + Intronic
1169921536 20:10739523-10739545 TGTCTTCTTAAAAAAGAAATGGG - Intergenic
1170290681 20:14765083-14765105 TGTATTCTCAAATTTAAAGAGGG - Intronic
1170512881 20:17097163-17097185 TGTCTTCTGTAGATAGAAGAAGG - Intergenic
1170766641 20:19294939-19294961 TTTATTGTTAAAATAGATGCTGG - Intronic
1171044017 20:21793626-21793648 TGAAGTCTTAAAATAGTGGAGGG - Intergenic
1171107065 20:22444384-22444406 TGTATTTTTAAGAAAGAAAATGG + Intergenic
1172285135 20:33734876-33734898 TGTATTTTTAATAGAGAAGGGGG + Intronic
1172858113 20:38024113-38024135 GGGATTCTTAACTTAGAAGAGGG + Intronic
1172928909 20:38567879-38567901 TGTATGCTTAAAAGAGAATACGG + Intronic
1173084873 20:39906224-39906246 TGTTTTCATAAAAAAGAGGAAGG - Intergenic
1173116693 20:40250290-40250312 TGATTTTTTAAAAAAGAAGAAGG + Intergenic
1173433166 20:43009534-43009556 TGCATTCTTCAAAGAGAAGAAGG + Intronic
1173483752 20:43424763-43424785 TGTATTCATAAAATAGAATATGG + Intergenic
1175104233 20:56603079-56603101 TGTATTTTTAAAATCCAGGAAGG - Intergenic
1176295236 21:5068528-5068550 TGTATTTTTAAAACAGATAATGG + Intergenic
1176408617 21:6435693-6435715 TGTATTTTTAAAAAAGATGGGGG - Intergenic
1177070904 21:16506421-16506443 TGTATCCATCATATAGAAGAAGG + Intergenic
1177362853 21:20096005-20096027 TATATACCTAAAATAGGAGAAGG + Intergenic
1177665355 21:24149920-24149942 TGTATTTTTGAAATACAATATGG + Intergenic
1178251829 21:31010471-31010493 TATATTCCTGAAATAGATGAAGG - Intergenic
1178479841 21:32970318-32970340 TGTCTTCTGAAAACACAAGAAGG + Intergenic
1178793229 21:35719575-35719597 TGTTTTCAGAAAATAAAAGAAGG + Intronic
1179063499 21:38002688-38002710 AGTATTGTTAACATAGAAAAGGG - Intronic
1179391575 21:40997094-40997116 AGTATTCTTCAAATAGCAGGTGG - Intergenic
1179684109 21:43044013-43044035 TGTATTTTTAAAAAAGATGGGGG - Intergenic
1179861813 21:44193600-44193622 TGTATTTTTAAAACAGATAATGG - Intergenic
1182876668 22:33697759-33697781 TGTGTTCTCAAAATAGAATGTGG - Intronic
1184017811 22:41799411-41799433 TCTATTGTTGAAATAGAATAAGG + Exonic
1184354389 22:43969265-43969287 TGTATGCTTTAAAAAGAGGAGGG + Intronic
949282879 3:2367296-2367318 TGTATTTTTAAAATAAAATCTGG - Intronic
950370784 3:12528415-12528437 TGGATTTTAAAAATAGATGATGG + Intronic
950402072 3:12776695-12776717 TGTCTTCCTAAAAGAGAAGGAGG + Intergenic
951548320 3:23851629-23851651 TTTATTCTTTATAGAGAAGAGGG - Intronic
951904981 3:27696622-27696644 TGTCTTCTTAAACCACAAGAGGG - Intergenic
952166726 3:30757810-30757832 TGTATTCTGGTAAGAGAAGAGGG - Intronic
952327312 3:32332955-32332977 TGTATTCTTATAAAACAAGAAGG + Intronic
952597892 3:35041462-35041484 TGTATGTTTACAATAGCAGATGG - Intergenic
952647730 3:35681930-35681952 AGTATTCTGAAAATAAAAGAAGG - Intronic
953039328 3:39240954-39240976 TGTAGTCTTGAATTATAAGACGG - Intergenic
953091785 3:39734531-39734553 TGTAATCTGAAGATTGAAGATGG - Intergenic
953995306 3:47514622-47514644 TGTATTTTTAATAGAGAAGGGGG - Intergenic
954051473 3:47982435-47982457 TATATTTTTAAACTAGATGATGG + Intronic
955029634 3:55203843-55203865 TGTTTTTTTAAAAAAGCAGAGGG + Intergenic
955050913 3:55410058-55410080 AGTATTCTTCAAAGAGGAGATGG + Intergenic
955657991 3:61264904-61264926 TGTATTTTTAAAATATCATAAGG + Intergenic
956264456 3:67381168-67381190 TTTATTTTGAAAATAGAAGTGGG - Intronic
956407103 3:68939368-68939390 TGTATTTTTAAAATAGAGATGGG - Intergenic
956525631 3:70156600-70156622 TGTATTTTAAAAAAAGAAGGGGG + Intergenic
956535412 3:70270669-70270691 TGTATTTTTAAAATACACCATGG + Intergenic
956649216 3:71488265-71488287 TTTAATCTTAAAATAGGAGTTGG + Intronic
956692300 3:71889501-71889523 TGTATTCAGAAGTTAGAAGATGG + Intergenic
957170576 3:76731823-76731845 TCTATTTTGAAAAGAGAAGATGG + Intronic
957175142 3:76798717-76798739 TGTATTTTTCAAATAGAGGCAGG - Intronic
957760155 3:84545302-84545324 TGTATTCCAAAAATTGAAGAGGG - Intergenic
957833764 3:85558053-85558075 TGCATTCTTAAAATATAATTAGG - Intronic
958094425 3:88924293-88924315 TTTATTCTTAAAATCTAAAATGG - Intergenic
958484717 3:94690197-94690219 TATATATTTAAAATGGAAGAAGG - Intergenic
958692447 3:97485044-97485066 TGTTTTCCTAAAATAGACAAGGG + Intronic
958716543 3:97789791-97789813 TTTATATTTAAAATAGAAAAAGG - Intronic
959344513 3:105176459-105176481 TGTTTTCTTAAAATAGAACATGG + Intergenic
959685221 3:109138474-109138496 TGTATTCTTAAAAGAAAATGTGG - Intergenic
959749819 3:109820242-109820264 TGCATGTTCAAAATAGAAGAGGG + Intergenic
960191165 3:114707688-114707710 TGTAGACTGCAAATAGAAGATGG - Intronic
960260155 3:115558354-115558376 TGTATTCTAACAATAGACAATGG + Intergenic
960568537 3:119161977-119161999 TTTATTCTTTAAATGGAAGAAGG - Intronic
960923691 3:122775154-122775176 TTTATTTTTAAAATACAAAAAGG + Intronic
961570617 3:127795782-127795804 TGTATGCTTAAAAAGGAATATGG + Intronic
962613326 3:137099963-137099985 TGTTTTAATAAAATAGAAGTGGG + Intergenic
963309899 3:143698698-143698720 GTTATTTTTAAAAAAGAAGAGGG - Intronic
963394085 3:144709776-144709798 TGTATTCTTAGTAGAGAAGGGGG + Intergenic
963495780 3:146058759-146058781 TGTATACATAGAATAGATGAGGG + Intergenic
963538044 3:146552907-146552929 TGTATTCTTCAAATACACCATGG - Intergenic
963587609 3:147212430-147212452 AGTATCCTTAATATAGAAGGTGG + Intergenic
964130284 3:153279264-153279286 TGTATTTTTAAAATAGAGATGGG + Intergenic
965938719 3:174148429-174148451 TGTATTTCTAAATTAGCAGAGGG - Intronic
965999861 3:174934972-174934994 TGTATTTTTAAAAATGAATATGG + Intronic
966347791 3:178998103-178998125 TTTATTTTAAAAATAGAATATGG + Intergenic
966355658 3:179075926-179075948 TGTATTCTGAAAACAAAAGGGGG + Intergenic
966447718 3:180021953-180021975 TTAACTCTTAAAATAGAAGATGG + Intronic
966518592 3:180847456-180847478 TGTATTTTTAGAAGAGACGAGGG - Intronic
966760428 3:183413330-183413352 TGTATTCTTATAATAAAACTAGG + Intronic
968989271 4:3898028-3898050 AGTGTTCTTAAAATACAAGGAGG + Intergenic
970129531 4:12851898-12851920 TGACTTCCCAAAATAGAAGATGG - Intergenic
970684592 4:18551979-18552001 TTTATTCTTAATCTAGATGAAGG + Intergenic
970703033 4:18765713-18765735 TGGTGTCTTGAAATAGAAGAAGG + Intergenic
970903996 4:21193876-21193898 TTTATTTTTAAACTACAAGAAGG + Intronic
971871256 4:32242069-32242091 TGTTTTCTTAAAAAAAAAAAAGG + Intergenic
972187439 4:36547799-36547821 TGAATTCTCAAAATAGGACAAGG - Intergenic
972315133 4:37919356-37919378 GGTATTTTTAATATAGACGAGGG + Intronic
972542081 4:40048031-40048053 TGTATTTTTAGTATAGAACAGGG - Intergenic
972874004 4:43335835-43335857 TGTATTTTAAAAATAGAACCAGG + Intergenic
974191553 4:58510606-58510628 TTTTTTCTTAAAATATAAAAAGG + Intergenic
974247741 4:59342683-59342705 TGTAATCTTAAAATAGAGTGGGG + Intergenic
974429666 4:61779458-61779480 TGTATTTTTAATAGAGAACAGGG - Intronic
974440884 4:61915796-61915818 TGTACTCTGAAAATAGAAATAGG - Intronic
974731621 4:65874000-65874022 TGGATTTTTTAAATAGCAGAAGG - Intergenic
974735316 4:65923014-65923036 TTTCTTCTAAAAATTGAAGAAGG - Intergenic
975120165 4:70719523-70719545 TATGTTCTTAAAACAGAACAAGG - Intronic
975533712 4:75426908-75426930 AGTATTCTTATAATAAAAGGGGG + Intergenic
976083127 4:81378223-81378245 TGTATTCTTAAAGTAGGTTAGGG + Intergenic
976280462 4:83321807-83321829 TTTATTCTAAATATAGAATATGG - Intronic
976873669 4:89828328-89828350 TATATCCTAAAACTAGAAGAAGG + Intronic
978222654 4:106295187-106295209 TGTATTGATAAAATATAACATGG - Intronic
978300272 4:107260965-107260987 TGTATTCTTCAAACAGACCATGG - Intronic
978329854 4:107600603-107600625 TGTAATCTTAGAACAGAATAAGG - Intronic
978454960 4:108878949-108878971 TGAATTCCTAAAAGAGAAAAAGG - Intronic
978659482 4:111107391-111107413 TGTATGCTTACAATCAAAGAAGG + Intergenic
978674190 4:111291184-111291206 TGTATTTTTAAAATTGATAATGG + Intergenic
978682663 4:111400853-111400875 TCTGTGCTTAAAATAAAAGAAGG - Intergenic
979590692 4:122476752-122476774 ACTCTTCTAAAAATAGAAGAGGG - Intergenic
979807979 4:124998749-124998771 AGTGTTCTTCAAATACAAGATGG + Intergenic
979818280 4:125138349-125138371 TGTATTATAAAAATACAATAAGG + Intergenic
979880842 4:125957665-125957687 TATATTCTTAATATAGAAATAGG + Intergenic
980036364 4:127887154-127887176 TTTATGCTTAAATTATAAGAGGG + Intronic
980796741 4:137695109-137695131 AGTATTCTATAAATACAAGATGG - Intergenic
981209114 4:142080684-142080706 TGTTTATTTAAGATAGAAGAGGG - Intronic
981447705 4:144859414-144859436 GGTCTTTCTAAAATAGAAGAAGG + Intergenic
981679369 4:147377713-147377735 TATTTTCTTAAACTAGAAGTAGG - Intergenic
981891528 4:149744357-149744379 TGTCTTCTTTAAGTATAAGAAGG + Intergenic
981967548 4:150623084-150623106 TGTACTCTTGGATTAGAAGAAGG + Intronic
981977275 4:150746024-150746046 TGTATTCTGAAAAGTGAACAGGG - Intronic
982520404 4:156409310-156409332 TGTTTTCTTAACATCCAAGATGG - Intergenic
983968197 4:173840207-173840229 CGTTTTCTTAAAATAGCAGTGGG - Intergenic
984045295 4:174790669-174790691 AGTATTTTTAAAAGAGAAGGAGG - Intronic
984542400 4:181055979-181056001 TGTATTTTTAGTATAGATGAGGG + Intergenic
984798117 4:183685757-183685779 TGTGTTTTTAAAATTAAAGATGG + Intronic
986587172 5:9330452-9330474 TGTTTTTTTACAATAGCAGAAGG + Intronic
986900659 5:12428730-12428752 TGTATTCTAAGAAAAGGAGAGGG - Intergenic
987157279 5:15102222-15102244 TGTCTTTTTAAAACAGAAAAGGG - Intergenic
987780958 5:22434713-22434735 TGTAGTCTTAAAATGGACAATGG - Intronic
988281167 5:29148950-29148972 TACATTTTTAAAAAAGAAGAGGG - Intergenic
988697243 5:33634720-33634742 TGTATTAGTGAAATATAAGAAGG + Intronic
988828183 5:34961456-34961478 TGCCTTCTGAAAATAGAAAAGGG + Intergenic
989525200 5:42445683-42445705 TGTGTTTTTAAATCAGAAGATGG - Intronic
989531166 5:42509768-42509790 TGGATTCCTAAAATAGGAGCAGG - Intronic
989649780 5:43674057-43674079 TGTATTATTAAAGGATAAGAGGG - Intronic
990317235 5:54594683-54594705 TGTATTTTTAAAATACAATTTGG - Intergenic
990466281 5:56074663-56074685 TGTATTTTTTAAAAAGAAGCAGG - Intergenic
990968474 5:61476648-61476670 CATATTCTTAAAAAAGAAGCTGG + Intronic
991074039 5:62515073-62515095 TGTTTTGTTAAAAAAGAAGCAGG + Intronic
991154567 5:63416298-63416320 TGTGTTATTAAAATGGCAGAAGG + Intergenic
991629712 5:68644365-68644387 TTTCTTTTTAAAATAAAAGAAGG + Intergenic
992972532 5:82077148-82077170 TGTATTTTTAAAATAGAGATGGG - Intronic
994959255 5:106577886-106577908 TGTCTTCTTTAAATGGAATATGG + Intergenic
995142855 5:108752468-108752490 TGTTACCTTAAATTAGAAGAGGG + Intronic
995941186 5:117586611-117586633 TGTAGTCTGAAGATAAAAGACGG - Intergenic
996020399 5:118584997-118585019 TGCATTTTTAAAACAGATGATGG + Intergenic
996160049 5:120150026-120150048 TGTATTGTTTAAATAGGGGAGGG - Intergenic
996960517 5:129242989-129243011 GGCATTCTTCAAATATAAGAAGG - Intergenic
997110491 5:131068966-131068988 TTTGTTCTTAAAACAGTAGATGG - Intergenic
998107892 5:139480141-139480163 TATATTTTTTAAAAAGAAGAGGG - Intronic
998850303 5:146345155-146345177 TTTATTTTTTAAATCGAAGAAGG + Intergenic
999751586 5:154631710-154631732 TGTATTTTTAAAGTAGAAATAGG - Intergenic
1000481869 5:161786538-161786560 ACTATTATTAAAATAGAGGATGG + Intergenic
1000570239 5:162903208-162903230 TGTATTGTTAAACGACAAGAAGG + Intergenic
1000752072 5:165108965-165108987 TGTATCTTTAAAAAAGAAAAAGG - Intergenic
1002897361 6:1387424-1387446 TATTTTCATAAAATAGAAGCTGG - Intergenic
1003074901 6:2974758-2974780 TGTATTCTTAGTAGAGATGAGGG + Intergenic
1003480023 6:6522698-6522720 TTAATTCTTAAAATAAAAGAAGG + Intergenic
1003579752 6:7329104-7329126 TGTATTTTTAATAGAGACGAGGG + Intronic
1005006377 6:21291210-21291232 TGTATTTTTAATAGAGATGATGG + Intergenic
1005189621 6:23205424-23205446 TGATTCCTTAAAATAGCAGAAGG - Intergenic
1005204589 6:23387044-23387066 TGTATTCTTAAGTTATAAAAAGG - Intergenic
1005215455 6:23522122-23522144 TTTAATATTAAAATTGAAGAAGG - Intergenic
1005790281 6:29293218-29293240 TGTATTTTTAAATTAAAATATGG + Intergenic
1005830536 6:29667627-29667649 AGTTTTCCTAAAATAGAAAAAGG - Exonic
1007540950 6:42643801-42643823 TGTATTTTTAAAATACTAGAAGG + Intronic
1008322699 6:50136597-50136619 TGTATTCTTACAATATTAAAAGG - Intergenic
1008560086 6:52715168-52715190 TTTATCCTTTAAATAGAAAAAGG - Intergenic
1009185495 6:60569947-60569969 TGTATGTCTAAAATAAAAGATGG - Intergenic
1009488963 6:64263134-64263156 TGTATTATTAAAAAAGAATCTGG + Intronic
1010830420 6:80521491-80521513 TGTATGCTTAAAATACAATTAGG - Intergenic
1010879138 6:81146509-81146531 TGCATTATTAAAATAGCAGAAGG + Intergenic
1010954944 6:82079584-82079606 TTCATTGTTAAAATAGGAGAAGG - Intergenic
1011266684 6:85528285-85528307 TGAATTCTTAAAGTCAAAGAGGG - Exonic
1011759635 6:90547946-90547968 AGGATTTATAAAATAGAAGATGG + Intronic
1012392640 6:98760401-98760423 TGCCTTCATAAAATTGAAGAGGG - Intergenic
1012790315 6:103685439-103685461 TGTATATTTAAAATTGTAGAAGG - Intergenic
1012809310 6:103937791-103937813 TGTATTCTTAATATAGCATCTGG - Intergenic
1013226134 6:108120292-108120314 TTTATTCTTAAACTTGAGGAGGG - Intronic
1013721451 6:113034376-113034398 TGTTTCCTTAAAATACAAAAAGG - Intergenic
1014291913 6:119568534-119568556 TGGATTCTGAAAATAGTAAATGG - Intergenic
1014444828 6:121514930-121514952 TGTATTTTTAATAGAGAAGGGGG + Intergenic
1015865649 6:137723843-137723865 TGTTTTCTTTTAAGAGAAGAGGG + Intergenic
1015885052 6:137909395-137909417 TGTGGTTTTAAAGTAGAAGAAGG + Intergenic
1016058161 6:139600664-139600686 TGTTTCCTCAAAAGAGAAGAAGG - Intergenic
1016733538 6:147451670-147451692 TGTATTCTTACAATAAAGTAAGG + Intergenic
1017261265 6:152390495-152390517 CATTTTTTTAAAATAGAAGAAGG - Intronic
1017279037 6:152603658-152603680 TGTATTCTAGATATAGAATAGGG - Intronic
1017476186 6:154795705-154795727 TGTATTGTAGGAATAGAAGAAGG + Intronic
1017554238 6:155545803-155545825 TGTAATTTCAAAAGAGAAGAAGG - Intergenic
1017773181 6:157659115-157659137 TTTATTATGAAAATAGATGAGGG + Intronic
1018152646 6:160954882-160954904 TGTAGTTTTAAACTACAAGAAGG + Intergenic
1018408301 6:163511365-163511387 TAAATTCTTGAAATAGAATACGG + Intronic
1019423010 7:959825-959847 TGTATTTTTAACAGAGACGAGGG + Intronic
1021562658 7:21984547-21984569 TGTAATCTAAAAATACAACAGGG + Intergenic
1021854865 7:24844682-24844704 TGTATTCTGAAAATAAAAATAGG + Intronic
1022020110 7:26391193-26391215 TGTATTTTTAAAATAGAGGCAGG + Intergenic
1022257838 7:28677092-28677114 TTTTATCTTAAAATAGAAGAGGG + Intronic
1022420877 7:30222517-30222539 TTTATCCTTAAAATAGCTGAGGG - Intergenic
1022465658 7:30651881-30651903 GGTGTTTTTAAAATAGATGAGGG + Intergenic
1022617333 7:31944836-31944858 TGTATTTTTTAAGTAGATGATGG - Intronic
1022827265 7:34028105-34028127 TGTAGTTTTAAAATAGAGGAGGG - Intronic
1022916712 7:34963019-34963041 TGTATTTTTAATAGAGATGAGGG - Intronic
1023602508 7:41893633-41893655 TGTCTTCATATGATAGAAGAGGG - Intergenic
1024167011 7:46745302-46745324 TGTCTTCTTAAAATTGAAAGTGG + Intronic
1024413069 7:49069661-49069683 TGTATTCTTAGAATAAAGTAAGG - Intergenic
1025239886 7:57262459-57262481 TCTATTCTTAAAACAGGTGAAGG - Intergenic
1025754369 7:64322074-64322096 TATGTTCTAAACATAGAAGAAGG + Intronic
1025817128 7:64924388-64924410 TTTATTCTTACTATAGAAAATGG + Intronic
1026101659 7:67389167-67389189 TGTATTTTTAAAATAGAGATGGG + Intergenic
1026408462 7:70093430-70093452 TGGATTTTTAAAAAACAAGATGG + Intronic
1026492579 7:70875530-70875552 TGTATTTTTAGTAGAGAAGAGGG + Intergenic
1028290807 7:89062837-89062859 TGGATCCTTAAAATATCAGAAGG - Intronic
1028320786 7:89457897-89457919 TGTATTTTTAAAATATAAACAGG + Intergenic
1028498894 7:91496110-91496132 TGTAATTTTGAAATAAAAGAAGG - Intergenic
1028760848 7:94494476-94494498 TAAATTCTTAAATTAGAATACGG + Intergenic
1029621027 7:101689792-101689814 TATATTCATAAAAGAAAAGAAGG + Intergenic
1029861432 7:103576479-103576501 TTTATTATTAAAAGAGCAGAAGG - Intronic
1030755213 7:113279371-113279393 TGTTTTCCAGAAATAGAAGATGG + Intergenic
1030806289 7:113923596-113923618 TGAATTCTAAAACTAGAAGTTGG - Intronic
1030837226 7:114304373-114304395 TATATTGTTAAAATAGATGCTGG + Intronic
1030981718 7:116193313-116193335 TGTAATCTTAAAAAATAATATGG - Intergenic
1031729672 7:125283296-125283318 GGTTTTCTTAAAACAGTAGAGGG - Intergenic
1033440866 7:141377441-141377463 TGATTTCTTAAAATAGAAGCAGG - Intronic
1035899046 8:3437613-3437635 TCTCTTCTTTACATAGAAGATGG + Intronic
1037235048 8:16710101-16710123 TTTATTTTTAAAATAAAAAATGG + Intergenic
1038703032 8:29868658-29868680 TGTATTTTTAGTATAGACGAGGG - Intergenic
1040509391 8:48080849-48080871 GGTATACGTAAAATAGATGAAGG - Intergenic
1040723914 8:50357993-50358015 TGGATTTTTAAAAAATAAGAAGG - Intronic
1040979867 8:53235559-53235581 TGTATTTTGAAAATACAAAATGG + Intronic
1041433637 8:57813750-57813772 TTTATTCTTAAAAGAGAAAGTGG - Intergenic
1042460275 8:69057769-69057791 TGGAATCCTAAAATATAAGAGGG - Intergenic
1042826786 8:72987552-72987574 TGTAATCTTAAAGTAGGTGAGGG + Intergenic
1043011459 8:74886503-74886525 TGTATTTTTAGTAGAGAAGATGG - Intergenic
1043049536 8:75367437-75367459 AGTATACATAAGATAGAAGAAGG + Intergenic
1043149339 8:76694289-76694311 TGTATTCTTCAATTAGAAAGAGG - Intronic
1043188165 8:77181867-77181889 TGTAAACCTAAAATAGAATAGGG - Intergenic
1043247896 8:78029283-78029305 TTTAATCTTTAAATAGAAGTTGG - Intergenic
1043254210 8:78112781-78112803 TGTATTCTTCAATTAGGTGAGGG - Intergenic
1044151344 8:88779407-88779429 TGTATTTTTATATTAAAAGAAGG - Intergenic
1045038592 8:98198520-98198542 TGTCTTCTTCTAATAGAAGGTGG + Intronic
1045316838 8:101050665-101050687 TTTATTCTTAAAAAAGAAAATGG - Intergenic
1045761250 8:105610416-105610438 TGAAAAGTTAAAATAGAAGAAGG + Intronic
1046044925 8:108953439-108953461 TGTATTCTTAATTCAGAAGTTGG - Intergenic
1046154645 8:110271891-110271913 TGTATTTTTGAACTAGAGGAAGG + Intergenic
1046807941 8:118500829-118500851 TGTATTCTGATCATAGATGAAGG - Intronic
1047319389 8:123765344-123765366 TGTATACTTAAAAAATAATAAGG + Intergenic
1047898537 8:129394309-129394331 TGTAGTCTGAAAATATTAGATGG - Intergenic
1047964675 8:130037442-130037464 TGTATTTTTAAAATAGAGACAGG + Intergenic
1048100854 8:131349816-131349838 TGCATTCTGAAATTAGAAGTGGG + Intergenic
1048228213 8:132611194-132611216 AGTATTATTAAAATAGAAAAAGG - Intronic
1048781910 8:138011262-138011284 TTTATTCTCAAAGTAGAATAAGG + Intergenic
1048880999 8:138872463-138872485 TGTGTCCTCAAAATAGAAGTAGG + Intronic
1048900513 8:139032784-139032806 GGTATAGTTAAAATAGAAGTGGG + Intergenic
1049941502 9:550323-550345 TGTATTATTAAATAAGAAGGAGG - Intronic
1050099208 9:2100312-2100334 TGTATTCTGAAAACAGAAGCTGG + Intronic
1050812827 9:9771004-9771026 GGTATTCTTACAAAAGCAGATGG + Intronic
1050873486 9:10605977-10605999 AGTAGTTTGAAAATAGAAGAGGG + Intronic
1050980723 9:12010816-12010838 TATATACTTAAAATAGGATATGG + Intergenic
1050986024 9:12083673-12083695 TGTTTTATTAAAATAAAAAATGG + Intergenic
1052293602 9:26872435-26872457 TGTATTCTTAAAATATAAATTGG - Intronic
1052527245 9:29633922-29633944 TGAATTATCAAAACAGAAGAAGG + Intergenic
1052875283 9:33555642-33555664 AATATTTTTAAGATAGAAGAGGG + Intronic
1053483784 9:38436799-38436821 TTTATCCTTAAAATAAAGGATGG + Intergenic
1053500733 9:38588707-38588729 AATATTTTTAAGATAGAAGAGGG - Intergenic
1056298090 9:85213733-85213755 TATATTTTAAAGATAGAAGATGG + Intergenic
1057141708 9:92730301-92730323 TGTTTTCCTAAAAGAGAAAAAGG + Intronic
1057680133 9:97173105-97173127 AATATTTTTAAGATAGAAGAGGG - Intergenic
1058091322 9:100808982-100809004 TGTGTTCCTAAAATAGTAAAAGG - Intergenic
1059334745 9:113561901-113561923 TGTATTCCAAAAATAGGAGGTGG + Intronic
1060350638 9:122856036-122856058 GGTATTTTTACAATAGAAAATGG + Intronic
1060626335 9:125115759-125115781 TTTATTCTTCCAATAGGAGAGGG + Intronic
1061599036 9:131654184-131654206 AGTATTCTAAAATTAGAATATGG + Intronic
1185493987 X:540444-540466 TGTATTTTTAAAATAGAGACAGG + Intergenic
1186250196 X:7657463-7657485 TGTATTCCTAAGACAGAAGGTGG - Intergenic
1186414953 X:9375236-9375258 TGTGTTCTTTTAACAGAAGAGGG - Intergenic
1186825193 X:13332218-13332240 TGTTTTCTTAAAATATAAAGAGG - Intergenic
1186890296 X:13953210-13953232 TGTATTCGTGAAATAGAGGTTGG + Intergenic
1187054128 X:15725378-15725400 TGTATTTTTAAAATAGAGAAAGG - Intronic
1187418052 X:19110510-19110532 TGTATTTTTAGTAGAGAAGATGG - Intronic
1187433616 X:19247329-19247351 CATATCCTTAACATAGAAGATGG + Intergenic
1187872537 X:23776391-23776413 TGTATTTTTTAAAAAGAAGGGGG - Intergenic
1187987726 X:24832759-24832781 TGTATGAATAAAATAGAAAAGGG + Intronic
1188012162 X:25068720-25068742 TGTACTCTGAAGATAGAGGAAGG - Intergenic
1188131681 X:26442376-26442398 TTTCCTTTTAAAATAGAAGAAGG - Intergenic
1188182244 X:27070409-27070431 TGTCTTTTTAAAATACAAAAGGG - Intergenic
1190937584 X:55010307-55010329 TGTATTCTCTACATAGAAGTTGG + Intronic
1191077849 X:56475071-56475093 TGTCTGCTAAAAATAGAAAAAGG - Intergenic
1191910598 X:66145085-66145107 TGAGTTCTTACACTAGAAGATGG + Intergenic
1191974423 X:66855351-66855373 TGTATTACAAAAATAGATGATGG - Intergenic
1192303753 X:69935463-69935485 TGTTTTCTTATAAAAAAAGACGG - Intronic
1192572206 X:72215485-72215507 TGTATCCTAAAAAAAGAAGATGG + Intronic
1192703889 X:73507838-73507860 TGAATACTTAAATTAGAAAAGGG - Intergenic
1192783879 X:74319451-74319473 TGTTTTCTCAAAAGAGCAGATGG - Intergenic
1192804737 X:74498813-74498835 TGTTTTCTCAAAAGAGCAGATGG + Intronic
1193514090 X:82441791-82441813 TGTAAACTTAAAATAAAAGTTGG + Intergenic
1193798651 X:85908693-85908715 TGCATTCTGAAAAAACAAGATGG + Intronic
1194307516 X:92266916-92266938 TGTATTTTTAATAGAGACGAGGG + Intronic
1194378748 X:93167535-93167557 TCAATTCTCAAAATACAAGAAGG + Intergenic
1195311450 X:103635377-103635399 TGTATTTTTCAAACAGAAGTGGG + Intergenic
1195647764 X:107251698-107251720 ACTATTCTTAATATATAAGAAGG - Intergenic
1196019669 X:110977420-110977442 TGCATTTTTAAAATAGAAATTGG - Intronic
1197033735 X:121849723-121849745 TAACTTCTTAAAATACAAGAAGG + Intergenic
1197313600 X:124936434-124936456 TGTATTCTTAGAAGATAACAGGG - Intronic
1199057481 X:143315379-143315401 TGCATTCATAAAATAGGAGTAGG - Intergenic
1199199946 X:145075460-145075482 TGAATTCTGAGAATAGAAGGAGG + Intergenic
1199391338 X:147283186-147283208 CGTATTTTTCAAATAAAAGAAGG - Intergenic
1199784147 X:151089463-151089485 TTTATTGGTAAACTAGAAGAGGG - Intergenic
1201249064 Y:12037591-12037613 TCTGATCCTAAAATAGAAGACGG + Intergenic
1201465875 Y:14280101-14280123 TGTATTCCTAAGACAGAAGGTGG - Intergenic
1201718896 Y:17076003-17076025 TGTATTCTAAAATTAGAAACTGG - Intergenic