ID: 1106544519

View in Genome Browser
Species Human (GRCh38)
Location 13:30718487-30718509
Sequence ATGGAGAAAAGGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3668
Summary {0: 1, 1: 2, 2: 23, 3: 373, 4: 3269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106544519_1106544524 4 Left 1106544519 13:30718487-30718509 CCTTCCTCCATCCTTTTCTCCAT 0: 1
1: 2
2: 23
3: 373
4: 3269
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106544519 Original CRISPR ATGGAGAAAAGGATGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr