ID: 1106544524

View in Genome Browser
Species Human (GRCh38)
Location 13:30718514-30718536
Sequence TACCCATCCACTGTGCCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 149}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106544518_1106544524 5 Left 1106544518 13:30718486-30718508 CCCTTCCTCCATCCTTTTCTCCA 0: 1
1: 1
2: 28
3: 345
4: 3352
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149
1106544520_1106544524 0 Left 1106544520 13:30718491-30718513 CCTCCATCCTTTTCTCCATTGCA 0: 1
1: 0
2: 2
3: 49
4: 624
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149
1106544522_1106544524 -7 Left 1106544522 13:30718498-30718520 CCTTTTCTCCATTGCATACCCAT 0: 1
1: 0
2: 0
3: 19
4: 298
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149
1106544513_1106544524 16 Left 1106544513 13:30718475-30718497 CCACCCTTGCCCCCTTCCTCCAT 0: 1
1: 0
2: 26
3: 479
4: 4302
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149
1106544517_1106544524 6 Left 1106544517 13:30718485-30718507 CCCCTTCCTCCATCCTTTTCTCC 0: 1
1: 3
2: 34
3: 364
4: 2584
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149
1106544511_1106544524 29 Left 1106544511 13:30718462-30718484 CCATGTCTCTGACCCACCCTTGC 0: 1
1: 0
2: 3
3: 46
4: 348
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149
1106544514_1106544524 13 Left 1106544514 13:30718478-30718500 CCCTTGCCCCCTTCCTCCATCCT 0: 1
1: 1
2: 21
3: 235
4: 2144
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149
1106544512_1106544524 17 Left 1106544512 13:30718474-30718496 CCCACCCTTGCCCCCTTCCTCCA 0: 1
1: 0
2: 13
3: 129
4: 1388
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149
1106544519_1106544524 4 Left 1106544519 13:30718487-30718509 CCTTCCTCCATCCTTTTCTCCAT 0: 1
1: 2
2: 23
3: 373
4: 3269
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149
1106544515_1106544524 12 Left 1106544515 13:30718479-30718501 CCTTGCCCCCTTCCTCCATCCTT 0: 1
1: 2
2: 22
3: 305
4: 3387
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149
1106544521_1106544524 -3 Left 1106544521 13:30718494-30718516 CCATCCTTTTCTCCATTGCATAC 0: 1
1: 0
2: 3
3: 46
4: 455
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149
1106544516_1106544524 7 Left 1106544516 13:30718484-30718506 CCCCCTTCCTCCATCCTTTTCTC 0: 1
1: 1
2: 30
3: 308
4: 2296
Right 1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106544524 Original CRISPR TACCCATCCACTGTGCCCTT TGG Intronic
902076728 1:13792984-13793006 CACCTAATCACTGTGCCCTTGGG + Intronic
902334088 1:15744921-15744943 CACCCCTTCCCTGTGCCCTTGGG - Intronic
904972989 1:34433676-34433698 TACCCAGCTTCTTTGCCCTTGGG - Intergenic
906699942 1:47850510-47850532 TGTCCATGCAATGTGCCCTTAGG - Intronic
907553146 1:55321196-55321218 TTTCCTTCCACTGTCCCCTTTGG - Intergenic
908026567 1:59958293-59958315 AATCCTTCCACTGTGCCCTTTGG + Intergenic
910536815 1:88307481-88307503 TCCCCATCACCTGTTCCCTTTGG - Intergenic
910679947 1:89852802-89852824 TCCACATTCACTGAGCCCTTTGG - Intronic
913425059 1:118719545-118719567 TAAACATCGACTATGCCCTTAGG + Intergenic
914719787 1:150280475-150280497 GACCCACCCACTTTGCCCTCTGG - Intronic
915306051 1:154979640-154979662 GACCTATTCACTGTGCCCCTTGG + Intergenic
915461437 1:156072778-156072800 TCCCCAGCCTCTGTGCCCATGGG + Exonic
915695682 1:157739439-157739461 TACCCAGCCACAGGGCTCTTTGG + Intergenic
916947158 1:169740451-169740473 TACCCATTTTCTTTGCCCTTTGG - Intronic
920456032 1:206101746-206101768 TCCACATCCTCTGTGGCCTTAGG - Exonic
921748093 1:218760497-218760519 GACCCATCAACTGTCCTCTTAGG - Intergenic
922178200 1:223213487-223213509 TTCTCATCCCCTGTGGCCTTTGG - Intergenic
923984241 1:239362659-239362681 TATCCATCCACTGCAACCTTTGG + Intergenic
1063118644 10:3088589-3088611 CACCCATACTCTGGGCCCTTGGG - Intronic
1064552120 10:16513361-16513383 TATACAGCCACTGTGCCCTGTGG + Exonic
1069781999 10:70962754-70962776 TAACCATACACAGTGCCCATTGG - Intergenic
1070422963 10:76255638-76255660 TTCCCATCCACTGGGCCATGTGG - Intronic
1070523944 10:77278748-77278770 TATCCCTCAACTGTCCCCTTGGG - Intronic
1071291243 10:84190786-84190808 TACCCATCTACTGTGACATGTGG - Intergenic
1071475913 10:86024817-86024839 TACCCACCCACTGTTTCCCTGGG - Intronic
1073349588 10:102810277-102810299 AACCCAGCCACTGTGAGCTTTGG - Intronic
1077216059 11:1395598-1395620 TCCCCACCCACTGTGGCCCTGGG + Intronic
1079082951 11:17427013-17427035 TTCCCCTCCACTGGGCCCTGAGG + Intronic
1079564277 11:21862516-21862538 TTCCCTTCTACTGTTCCCTTGGG + Intergenic
1081523713 11:43908291-43908313 CACCCTTCCACTGTGTCCTCTGG - Intronic
1085554006 11:77402967-77402989 AACCCTTCCACTGTTCCCTCTGG + Intronic
1085838907 11:79987435-79987457 TACTCTTCCACTCTCCCCTTGGG + Intergenic
1088665066 11:112086267-112086289 TACTCATCCACTGTGGGTTTTGG - Intronic
1090544150 11:127744346-127744368 GACCCATCCATAGTGCTCTTTGG - Intergenic
1091034911 11:132224338-132224360 CACCCATCCACTGGGCTCTCTGG - Intronic
1091069023 11:132545636-132545658 TATCCATCCAATGTGTACTTAGG + Intronic
1092252735 12:6909861-6909883 AATCAATCCACTGTGCCCTGGGG + Intronic
1094676804 12:32628443-32628465 TGCCCTTCCACTGGGACCTTTGG - Intronic
1095380440 12:41584379-41584401 TGCCCATCCACTAAGGCCTTGGG - Intergenic
1096110554 12:49026771-49026793 TGCACCTCAACTGTGCCCTTTGG - Exonic
1098205055 12:68100247-68100269 TACTCATCCTCTGTACCCTGTGG - Intergenic
1100522150 12:95385496-95385518 TACCCATCCACCGTGCATTTCGG + Intergenic
1100643500 12:96505401-96505423 TACCCATTGACTTTGCCTTTTGG + Intronic
1102588094 12:113937220-113937242 TGCCCATCCTCTGTGACCCTTGG - Intronic
1102820195 12:115902025-115902047 GGCCCCTCTACTGTGCCCTTTGG - Intergenic
1102963636 12:117110307-117110329 TCCCCAGCCACTGTGTCCATGGG - Intergenic
1103084131 12:118048910-118048932 GAGCCACCCACAGTGCCCTTAGG + Intronic
1103213774 12:119186249-119186271 TTCACATCCACAGTGCCCTTAGG + Intronic
1103728094 12:123008861-123008883 TACACATCCACCCTTCCCTTGGG + Intronic
1104744113 12:131200260-131200282 TACTCACTCACTGTGTCCTTGGG - Intergenic
1106544524 13:30718514-30718536 TACCCATCCACTGTGCCCTTTGG + Intronic
1108208523 13:48115164-48115186 CACCCACCCAGTGTGCCCCTGGG - Intergenic
1108784004 13:53872445-53872467 CACCCACCCACTGATCCCTTTGG + Intergenic
1110560192 13:76903028-76903050 TGTACATCCACTGGGCCCTTTGG - Intergenic
1110612739 13:77507068-77507090 TACCCATGCACTTTTCACTTTGG - Intergenic
1111261517 13:85746500-85746522 TATCCATCCTGTGTTCCCTTTGG + Intergenic
1111759132 13:92439575-92439597 TACCCTTCCACTCTGCTCTCTGG - Intronic
1114400036 14:22401746-22401768 TATCAATCTACTGTGCCCTTTGG - Intergenic
1115379439 14:32718410-32718432 TACCCATCCCCTGACCCCTTGGG - Intronic
1117882652 14:60327625-60327647 GAGCCATCCACTGTGGGCTTGGG - Intergenic
1117942905 14:60988032-60988054 AACCCTTCCACTGTGCTCTCTGG + Intronic
1122218345 14:100219085-100219107 TACCAATGCAGTGTGACCTTGGG - Intergenic
1124552768 15:30696753-30696775 TTCCCCTCCACTGGGGCCTTGGG + Intronic
1124678474 15:31708917-31708939 TTCCCCTCCACTGGGGCCTTGGG - Intronic
1125088517 15:35761240-35761262 AACCCATCCCCACTGCCCTTAGG - Intergenic
1126373916 15:47975380-47975402 CCCCCATCCACAGAGCCCTTTGG - Intergenic
1128342728 15:66834013-66834035 TACTCAGCCTCTGTGGCCTTTGG - Intergenic
1129822651 15:78615423-78615445 CAGCCATCCACTGTGGCTTTGGG - Intronic
1130857657 15:87855383-87855405 TTCTCACCCACTGTGACCTTGGG - Intergenic
1134609905 16:15599570-15599592 TTACCGTCCCCTGTGCCCTTAGG - Intronic
1137864073 16:51875784-51875806 TATCCATCCATTATGCCCTATGG + Intergenic
1139466543 16:67156935-67156957 TCCCCCTCCACTGTGACCTTGGG - Intronic
1139834534 16:69827707-69827729 CACCCATGCTCTGTGCCCTCAGG - Intronic
1142229576 16:88893536-88893558 AACCCACCCAGTGTGTCCTTGGG - Intronic
1142425201 16:89998844-89998866 TACCCTTGCACTGGGCCGTTAGG + Intergenic
1142666215 17:1465351-1465373 AACACATCCACTGTGTCCTTGGG + Exonic
1142904815 17:3034518-3034540 TTTCCAGCTACTGTGCCCTTGGG + Exonic
1143517489 17:7427084-7427106 CACCCATCCACGGAACCCTTGGG + Exonic
1145864025 17:28228570-28228592 TAAACATCCACAGCGCCCTTAGG - Intergenic
1146491929 17:33289553-33289575 TACCCTTCCTCTCTGACCTTGGG - Intronic
1146630195 17:34464066-34464088 CCCTCATCCTCTGTGCCCTTTGG - Intergenic
1148981866 17:51583776-51583798 GACCTTTCCACTCTGCCCTTTGG + Intergenic
1149670536 17:58404548-58404570 TACCGATCCACTGTGACATTAGG - Intronic
1152927673 17:83094945-83094967 CACACATCCACTGTGCCCAACGG - Exonic
1153549897 18:6251557-6251579 TACACTTACACTGTGGCCTTGGG - Intronic
1154406419 18:14095968-14095990 TAGCCTTCCACAGTGGCCTTAGG - Intronic
1157343919 18:46806218-46806240 TACTCATTCACTGTGACCTTGGG + Intergenic
1158437492 18:57443550-57443572 TAACCAACCTCTGTGCCTTTGGG + Intronic
1159029756 18:63218816-63218838 TCCCCATCCACTCTGTCCCTTGG + Intronic
1161375716 19:3938087-3938109 TCCCCGTCCACTGTTCCCCTGGG + Intronic
1161375748 19:3938179-3938201 TACCCGTCCACTGTTCCCCCAGG + Intronic
1161375865 19:3938499-3938521 TCCCCATCCACCGTCCCCTGGGG + Intronic
1164607377 19:29609897-29609919 GACCCTGACACTGTGCCCTTAGG - Intronic
1168516292 19:57012914-57012936 CACCCATCCACTGCTCCCGTGGG - Intergenic
925849901 2:8069885-8069907 CACCCATCCACTCTCCCCTTCGG - Intergenic
927043984 2:19258504-19258526 TTCCCTTACACTGTGGCCTTGGG - Intergenic
930209611 2:48621051-48621073 TACCCATTCATTGTGCCATCAGG + Intronic
937021895 2:118664970-118664992 TACCCAGCCAATGGGCACTTTGG + Intergenic
940963905 2:159816578-159816600 TAGTCATCCACTGGGCCCTTGGG + Intronic
942800876 2:179873937-179873959 TCCCCATCCACTGTAATCTTTGG - Intergenic
944052762 2:195490053-195490075 TACCCATCTGTTTTGCCCTTGGG + Intergenic
944738091 2:202586470-202586492 TACACATCCCCTGTGACATTAGG - Intergenic
944973893 2:205025383-205025405 GACACATGCACAGTGCCCTTTGG + Intronic
946748599 2:222870518-222870540 TACCCATCCGCTGACCCCTTAGG - Intronic
948330108 2:237157835-237157857 AACCCAACCACTGTGTACTTAGG - Intergenic
1170850937 20:20003954-20003976 TCCACACACACTGTGCCCTTCGG - Intergenic
1173046452 20:39517365-39517387 GACCAATCTACTGTGGCCTTGGG + Intergenic
1176299332 21:5091139-5091161 TACCCAAGCCCTCTGCCCTTAGG + Intergenic
1177245400 21:18516377-18516399 TTCCCCTCCCCTGTACCCTTAGG - Intergenic
1179857694 21:44170808-44170830 TACCCAAGCCCTCTGCCCTTAGG - Intergenic
1180076133 21:45464011-45464033 GACCCAGCCACAGTGCCCATAGG - Intronic
1180939366 22:19647033-19647055 TACCCATACACAGAGCCCCTCGG + Intergenic
1184425422 22:44406408-44406430 TACACATCCCCAGTGCCCTTAGG - Intergenic
950874729 3:16261439-16261461 AACCCTTTCACTGTGCCCTTTGG + Intronic
951244586 3:20325708-20325730 TTCTCACCCACTTTGCCCTTTGG - Intergenic
960296122 3:115946246-115946268 TACCTACCCACTGAGCCCCTTGG - Intronic
960420535 3:117440040-117440062 TAGCCATAAACTGTGCTCTTTGG - Intergenic
961048438 3:123725894-123725916 CTCCCATCCCCTGGGCCCTTTGG - Intronic
964863839 3:161231837-161231859 AACCCTTCTACTGTGCCCTCCGG - Intronic
972713167 4:41619167-41619189 TACCCATCCTCTCTTCCCTAGGG + Exonic
977732599 4:100372029-100372051 TTAACATCTACTGTGCCCTTTGG + Intergenic
981127771 4:141126522-141126544 GTCCCATGCACTGTGACCTTGGG + Intronic
981686020 4:147455930-147455952 TACCCATCCTCTGAGCCATCTGG + Intergenic
982378515 4:154722400-154722422 CAGCCAACCACTGTGACCTTAGG - Intronic
984663956 4:182405483-182405505 TACCCATCATCTGTATCCTTAGG + Intronic
989174786 5:38513319-38513341 TAGCCACTCACTGAGCCCTTTGG - Intronic
997261651 5:132470042-132470064 TATCCATTCACTGTGCTGTTCGG - Intronic
997895119 5:137709347-137709369 CACTCATTCACTGTGACCTTGGG + Intronic
997981133 5:138467893-138467915 TACCCATCCCCTGTGCACAGTGG + Exonic
998498751 5:142613982-142614004 GTCCCATCCACTGTGCCATCCGG + Exonic
1000722909 5:164730545-164730567 AACCCCTCCACTGTGCTCTGTGG - Intergenic
1003198622 6:3938316-3938338 TACCTTTCCACTGTGGCCCTAGG - Intergenic
1006131456 6:31871628-31871650 TCCCAGTCCACAGTGCCCTTAGG + Intronic
1006791401 6:36703571-36703593 CACCCCACCCCTGTGCCCTTGGG - Intronic
1007070949 6:39037795-39037817 CACCCATCCACTCTGCCCTAGGG + Intergenic
1008139274 6:47813295-47813317 CACCCCTCCTCTGTGCCCTTTGG + Intronic
1008805346 6:55420082-55420104 TTCCCATACACTGTGGCCCTTGG + Intergenic
1012602414 6:101114501-101114523 AACCCTCCCACTGTGCCCTCTGG - Intergenic
1017687106 6:156924505-156924527 TTCCCATCCACTGGTCACTTAGG - Intronic
1019794017 7:3036465-3036487 TACCCCTCCCCTGTCCCCTAAGG - Intronic
1024304051 7:47911798-47911820 TTCACAGCCACTGAGCCCTTTGG - Intronic
1028198536 7:87934557-87934579 TAGCCGTCCTCTGTGCCTTTGGG + Intronic
1030101291 7:105947775-105947797 CACCTATGTACTGTGCCCTTGGG + Intronic
1032538812 7:132686452-132686474 TACCCACCCAGTGTGCCCATAGG + Intronic
1032544105 7:132727651-132727673 CACCCACCCACTGTGCTCCTTGG + Exonic
1034448042 7:151123327-151123349 TGTCCATCCACTGTGCCCCTTGG + Intronic
1036392263 8:8333860-8333882 CACCCATACCCTGTGCCCTGGGG + Intronic
1036761073 8:11508897-11508919 TGCCCATCCACTGAGAGCTTTGG + Intronic
1037291392 8:17352829-17352851 TCCCCATCCACAGTGCACTAGGG - Intronic
1039827757 8:41189400-41189422 TGGCCATCCTCAGTGCCCTTTGG + Intergenic
1044002417 8:86899960-86899982 TACCCCTCCTCTCTGCCCATTGG + Intronic
1045178892 8:99758751-99758773 TGCCCTTCCACTTTGCCCTCTGG + Intronic
1047329465 8:123873315-123873337 AATCCATCCATTGTGCTCTTTGG + Intronic
1047348826 8:124054088-124054110 TTCCCATCCCCTGTTCCCATGGG + Intronic
1047724284 8:127670728-127670750 TGCCCATACTCTGTGCCCTCAGG + Intergenic
1047933468 8:129752386-129752408 GACCCAGCCACTGTCCCCTGGGG - Intronic
1047944786 8:129864683-129864705 TACCCATACATTGCACCCTTAGG - Intronic
1048318590 8:133380589-133380611 TACCCAGCAACTGTGCTCCTTGG + Intergenic
1049403318 8:142440575-142440597 TTCCCATCCACTGTGCCAGCAGG - Intergenic
1055837261 9:80458165-80458187 TAGACAGGCACTGTGCCCTTGGG + Intergenic
1056260881 9:84847259-84847281 TACCCATTCACTCTGGCCTCTGG + Intronic
1057817542 9:98306614-98306636 TTCCCTTCCACTGTAGCCTTGGG - Intronic
1058689794 9:107510073-107510095 AACCAATCCCCTGTGCCCTCTGG - Intergenic
1187898823 X:24008693-24008715 AACCTTTCCACTGTGCCCTGTGG + Intronic
1187936677 X:24342975-24342997 TTCCTATCCAGTGTGCTCTTTGG + Intergenic
1189059879 X:37741875-37741897 TACGCCACTACTGTGCCCTTTGG - Intronic
1189651562 X:43195401-43195423 TAATCATACACTATGCCCTTGGG + Intergenic
1195449131 X:104990377-104990399 TACCCACCCTCTCTCCCCTTGGG + Intronic
1197722417 X:129754526-129754548 AACTCATCCACTGTGCCTTTGGG - Exonic