ID: 1106545029

View in Genome Browser
Species Human (GRCh38)
Location 13:30723259-30723281
Sequence ATGTGTTGATGATTTTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 427}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106545028_1106545029 29 Left 1106545028 13:30723207-30723229 CCAACAACTCATTGCTAAGGAGA 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1106545029 13:30723259-30723281 ATGTGTTGATGATTTTTGTGAGG 0: 1
1: 0
2: 3
3: 31
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106545029 Original CRISPR ATGTGTTGATGATTTTTGTG AGG Intronic
900851328 1:5145278-5145300 ATGTTTTCATTATTTTTTTGTGG + Intergenic
901256785 1:7835740-7835762 ATGTGTTGTTGATTTTTGACAGG + Exonic
902055829 1:13599671-13599693 ATGTGTTGCTTATTTTTTTATGG + Intronic
905949107 1:41931393-41931415 ATGAGGTGATTATATTTGTGTGG + Intronic
906574696 1:46877339-46877361 ATCTGGTGATGATCTTTGAGAGG - Intergenic
906597277 1:47090565-47090587 ATCTGGTGATGATCTTTGAGAGG + Intronic
906980063 1:50620649-50620671 TTGTGTTGATTCTTTATGTGTGG + Intronic
907790299 1:57657167-57657189 ATGTGTTGATGATTATTAAGTGG - Intronic
908678398 1:66631800-66631822 ATGTCTTGAGGAGTTTGGTGTGG - Intronic
909878174 1:80837647-80837669 ATGTGCTGCTGATCTTTTTGGGG + Intergenic
909970639 1:81982930-81982952 ATGTGTTGAAATCTTTTGTGAGG + Intronic
911701918 1:100963355-100963377 CTGTGTTGAATATTTCTGTGGGG + Intronic
911787701 1:101971048-101971070 CTGTTTTGATGACTTTTGAGTGG + Intronic
912687415 1:111778319-111778341 ATGTGCTGCTGATTCTTCTGGGG - Intronic
915795664 1:158731195-158731217 ATTTGGTGATGAGTTTTCTGGGG - Intergenic
916989282 1:170225030-170225052 ATGTACTTATCATTTTTGTGTGG - Intergenic
917568512 1:176237109-176237131 ATCAGTTGATGATATTTGTGTGG + Intergenic
918835270 1:189454511-189454533 ATGTGTTGTTGAATTTGGTTTGG + Intergenic
918903253 1:190453816-190453838 ATTTGTTGTGTATTTTTGTGTGG - Intronic
918930809 1:190854474-190854496 ATGTGTTGCTGAATTTGGTTTGG + Intergenic
919317721 1:195996294-195996316 ATGTATTCAGGATTTTTCTGGGG + Intergenic
919795917 1:201321434-201321456 AGGTGTTGCTGTGTTTTGTGTGG + Intronic
920985005 1:210880035-210880057 ATGTGTTTAAGATCTATGTGAGG + Intronic
921550380 1:216528139-216528161 ATATGTTGATGTATTTTCTGTGG - Intronic
921728536 1:218551513-218551535 ATGTATTTGTGATTTTTTTGTGG + Intergenic
921804553 1:219438611-219438633 ATGTGTTTATAATTGTTGTGTGG - Intergenic
922678426 1:227568619-227568641 ATGTTTTGCTGAGTTCTGTGAGG + Intronic
924900488 1:248393107-248393129 CTGTGCTGAGGATTTTTCTGAGG + Intergenic
1062953903 10:1527373-1527395 CTGTTTTGATGATTTTTACGGGG + Intronic
1063932187 10:11039959-11039981 ATGTATTGATTATCTTTATGTGG + Intronic
1063938700 10:11106096-11106118 ATGTCTTGATCATTTTTGGAAGG + Intronic
1064866098 10:19882262-19882284 ATGCATTGATGTTTATTGTGTGG - Intronic
1065202527 10:23327877-23327899 TTGTGTTGAGGCTTTGTGTGAGG - Intronic
1065716837 10:28578663-28578685 ATGTTTTGATGAATTTTTTTTGG + Intronic
1066981226 10:42418357-42418379 CTGTGTTGACGATATATGTGGGG - Intergenic
1067461021 10:46458730-46458752 ATGTGGTCATATTTTTTGTGAGG - Intergenic
1067581366 10:47448370-47448392 ATGTGTGGGTGTTTTGTGTGTGG + Intergenic
1067626173 10:47925869-47925891 ATGTGGTCATATTTTTTGTGAGG + Intergenic
1068280764 10:54866008-54866030 ATATGATCAAGATTTTTGTGAGG + Intronic
1068473261 10:57492117-57492139 ATGTGTTTATGTATTTTCTGAGG + Intergenic
1068612484 10:59075607-59075629 TTGTGTTAATGATTTTTCTGTGG - Intergenic
1069415107 10:68192377-68192399 ATGTGTTGTTGAATTTAGTTTGG + Intronic
1069758535 10:70790473-70790495 ATGTGTTGAGGTTTGTTCTGTGG + Intergenic
1070181771 10:74020889-74020911 ATCTGTTTATGATGTATGTGTGG + Intronic
1070433252 10:76362243-76362265 ATGTGATCGTGATTTTTGTAAGG + Intronic
1070738454 10:78883933-78883955 TTTTGTTGATGCTTTTTGTCAGG - Intergenic
1071065144 10:81623588-81623610 CTGTGTTGATATTTTTTGTCTGG + Intergenic
1071312786 10:84359331-84359353 ATGTTTAGTTGATTTATGTGAGG + Intronic
1071795869 10:89005055-89005077 TGTTGTTGATGAATTTTGTGAGG + Intronic
1071968251 10:90875088-90875110 ATACAATGATGATTTTTGTGAGG + Intronic
1072267450 10:93744243-93744265 ATGTGTTGTTCATTTCTCTGAGG - Intergenic
1072288706 10:93942137-93942159 ATGGGTTGATGGTTTTTGACAGG - Intronic
1073340290 10:102739088-102739110 ATGTGTGTATGAGTTTTGTCTGG + Exonic
1073742742 10:106427634-106427656 ATGTATTGAATATTTGTGTGAGG + Intergenic
1073831101 10:107384530-107384552 ATGTGTGGAAGATGTTTCTGTGG - Intergenic
1074003137 10:109392393-109392415 ATGTGTACATGTCTTTTGTGTGG - Intergenic
1074034190 10:109721416-109721438 ATGTGTACATGTTTTGTGTGAGG - Intergenic
1074657758 10:115614417-115614439 ATTTGTTGATGCTTGTTTTGTGG + Intronic
1074672071 10:115802452-115802474 AAGAATTGATCATTTTTGTGAGG + Intronic
1074822762 10:117193753-117193775 ATCTGTTGAACATATTTGTGTGG - Intergenic
1077359073 11:2132684-2132706 ATGTTTTGATTTTTTATGTGTGG + Exonic
1077427736 11:2492663-2492685 ATGAGTTCATGTCTTTTGTGGGG - Intronic
1077724687 11:4662205-4662227 ATACATTTATGATTTTTGTGGGG + Intergenic
1077821695 11:5750334-5750356 ATGTCTTAATGAATTATGTGTGG - Intronic
1078394495 11:10967973-10967995 TTGTGTTTATAATTTTTTTGAGG - Intergenic
1079341286 11:19613545-19613567 ATGTCTTGATGATGTTGGAGGGG + Intronic
1079469315 11:20763381-20763403 ATGTGTTAATATTTGTTGTGTGG + Intronic
1079518869 11:21301056-21301078 ATGAGTTCATGTTCTTTGTGGGG - Intronic
1079903797 11:26221060-26221082 CTGTGTAGAGGATTATTGTGTGG - Intergenic
1080069717 11:28067158-28067180 ATGTTTACATTATTTTTGTGGGG + Intronic
1080531597 11:33181672-33181694 ATTTATTGATGATTATTGTATGG - Intergenic
1081175111 11:39918377-39918399 ATGTGTTGATGACTTTGACGTGG - Intergenic
1081420334 11:42868522-42868544 CTGTGTTGGTGATTTGTGTGGGG - Intergenic
1082200681 11:49362964-49362986 ATGTATTTCTGATATTTGTGTGG + Intergenic
1082557438 11:54579411-54579433 ATGAGTTCATGTTTTTTGTAGGG + Intergenic
1082557629 11:54581629-54581651 ATGAGTTCATGTTTTTTGTAGGG - Intergenic
1082894034 11:58171139-58171161 ATGTGTCTATGATTATTTTGTGG + Intronic
1083169777 11:60916309-60916331 ATGTTATAATAATTTTTGTGTGG - Intronic
1085066714 11:73502185-73502207 ATTTGTTGATTTTTTTTTTGAGG - Intronic
1086584933 11:88440143-88440165 ATCAGTTGATGATATTTGTGTGG + Intergenic
1086654989 11:89343282-89343304 ATGTATTTCTGATATTTGTGTGG - Intronic
1087373623 11:97316924-97316946 TTGTGTTGAGGATTTTTGCATGG + Intergenic
1087624406 11:100580550-100580572 GTGTGATGAACATTTTTGTGGGG + Intergenic
1090847181 11:130539910-130539932 TTTTATTGAGGATTTTTGTGTGG + Intergenic
1092396339 12:8130309-8130331 ATGTGATGATGATTTTTTTATGG + Intronic
1093306091 12:17522254-17522276 ATGTGTGTATGTATTTTGTGGGG - Intergenic
1094496113 12:30990417-30990439 ATGGTTTGATGATTTTCCTGTGG - Intronic
1098138591 12:67428845-67428867 ATATGGTGATGATTATAGTGAGG - Intergenic
1098213763 12:68194065-68194087 ATGTGCTGATGAATTTGGTTTGG + Intergenic
1099065362 12:77970766-77970788 ATGTGTTATTATTTTTTGTGTGG + Intronic
1099531478 12:83787653-83787675 ATGAGTTCATGTTCTTTGTGGGG - Intergenic
1099711114 12:86225557-86225579 ATGTGCTGATGGATTTGGTGTGG - Intronic
1099712063 12:86240763-86240785 ATATGTTGATAATTTTAATGTGG - Intronic
1100509718 12:95257610-95257632 AGGTCTTTGTGATTTTTGTGAGG + Intronic
1101169452 12:102074831-102074853 ATTTGTTTTTGTTTTTTGTGTGG - Intronic
1103995967 12:124830365-124830387 ATTTGTGGATAATCTTTGTGTGG - Intronic
1104757469 12:131278074-131278096 CTGTCTGGCTGATTTTTGTGTGG + Intergenic
1106219402 13:27733263-27733285 ATGTTTGTATGATTTCTGTGAGG - Intergenic
1106341532 13:28833322-28833344 ATATGTTGCTGATTTCTGTTTGG - Intronic
1106545029 13:30723259-30723281 ATGTGTTGATGATTTTTGTGAGG + Intronic
1106659754 13:31786299-31786321 ATGGGATGATGATAATTGTGAGG + Intronic
1106705858 13:32278714-32278736 GTGTGTTGATGGGATTTGTGGGG + Intronic
1107542615 13:41405910-41405932 CCATGTTGATGAATTTTGTGTGG - Intergenic
1108831574 13:54486060-54486082 ATGTAGAGATGATTTTTGTATGG - Intergenic
1108928933 13:55790420-55790442 ATGTATTAATAATTTTTCTGAGG + Intergenic
1109129716 13:58567692-58567714 ATCTGTTGAGCATATTTGTGGGG + Intergenic
1109184998 13:59257862-59257884 ATGTGTTTCTGAATTTAGTGTGG + Intergenic
1109652653 13:65350646-65350668 ATGTGTTGAATATTTTTCTGGGG - Intergenic
1109734067 13:66457828-66457850 AAGTGTTGGTGATTTTTTTGGGG + Intronic
1110713241 13:78672953-78672975 ATGGGTTGAAAATTTTTATGTGG + Intergenic
1111183830 13:84702572-84702594 AGATGTTGATGATTTATGAGAGG + Intergenic
1111200654 13:84931865-84931887 AAGTCTTGAAGATTTTTGTGGGG - Intergenic
1111495947 13:89050354-89050376 ATGTAATGATGAGTTTTTTGTGG + Intergenic
1112061127 13:95741238-95741260 ATGTGTTTGTGATTTTGGTTGGG + Intronic
1112346633 13:98595550-98595572 ATCTGATGATGATTTTTCTTAGG + Intergenic
1112678342 13:101731376-101731398 ATCTGTTGTTGATTTTGTTGTGG - Intronic
1112995543 13:105570250-105570272 AAGTGTTTATGATTTTAGTATGG + Intergenic
1113039217 13:106086001-106086023 ATGTATTTTTAATTTTTGTGGGG - Intergenic
1113247444 13:108413509-108413531 ATGAGTTCATGTTCTTTGTGGGG - Intergenic
1114131261 14:19796062-19796084 ATTTGTTCCTGATTTTTATGAGG - Intronic
1114990022 14:28274749-28274771 AAGTGTGGATGATTTTAGGGAGG - Intergenic
1115700877 14:35951841-35951863 AGGTGTTGATGATACTGGTGAGG - Intergenic
1116061875 14:39933935-39933957 CTGTGTTGATGACTTGTGTTGGG - Intergenic
1116082707 14:40196142-40196164 ATGTATTTATCATTTTTATGTGG - Intergenic
1117326923 14:54677674-54677696 ATGAAATGAAGATTTTTGTGGGG + Intronic
1117551163 14:56837817-56837839 ACATTTTCATGATTTTTGTGAGG + Intergenic
1118573880 14:67222294-67222316 GTTTGTTGTTGTTTTTTGTGAGG + Intronic
1119972513 14:78987479-78987501 ATGTATTGATGTTTTTTAGGGGG - Intronic
1120317413 14:82913528-82913550 ATCTCTTGACTATTTTTGTGTGG - Intergenic
1121141194 14:91544092-91544114 ATATGTTGGGGATATTTGTGTGG - Intergenic
1121323940 14:93008928-93008950 AGTTGTTTCTGATTTTTGTGTGG - Intronic
1121966652 14:98313169-98313191 ATGAGTTCATGTTCTTTGTGGGG - Intergenic
1123910934 15:24966422-24966444 AGATGTCGATGATTTTTGTTGGG + Intronic
1123974680 15:25542075-25542097 CTGTTGTGCTGATTTTTGTGGGG - Intergenic
1124238708 15:28012487-28012509 ATGTGTGGCTGGTTTCTGTGTGG + Intronic
1124896293 15:33780352-33780374 ATGGGTTGATGACCTTTGAGGGG - Intronic
1125416221 15:39456030-39456052 TTTTGTTTCTGATTTTTGTGTGG - Intergenic
1125527926 15:40390084-40390106 ATGTGATGTTGATTTTTGCCTGG + Intronic
1125635552 15:41185501-41185523 ATGCCTTGCTAATTTTTGTGGGG + Intronic
1126450072 15:48797627-48797649 GTGTGATGATGACTTTGGTGAGG - Intronic
1126712272 15:51472245-51472267 ATTTGTTGATGAATTGTGTCTGG - Intronic
1128470947 15:67952500-67952522 ATCTGTTGCAGGTTTTTGTGTGG - Intergenic
1129027779 15:72595012-72595034 ATTTGTTGATAATTTTTATTAGG + Exonic
1129645326 15:77424915-77424937 ATGTGTAGATGAATAATGTGAGG - Intronic
1129708334 15:77807247-77807269 ATGTAGTGATTATGTTTGTGTGG + Intronic
1129998502 15:80027154-80027176 ATGTGGTGTTGAATTTTGTAGGG - Intergenic
1130207144 15:81887668-81887690 ATGTATTTATAATGTTTGTGGGG - Intergenic
1131784861 15:95901505-95901527 AGGTGTTGATGACTTTAATGGGG - Intergenic
1131921082 15:97329313-97329335 ATGTATATATGATTTTTATGAGG + Intergenic
1132151507 15:99464948-99464970 ATCTGTTGGTCATTTTTCTGTGG - Intergenic
1133650680 16:7810730-7810752 GTTTGTTGATGTTTTTTATGTGG - Intergenic
1133884290 16:9811091-9811113 ATGTGTTTATAATTTTACTGTGG + Intronic
1134033460 16:11011196-11011218 ATTTGTTGATGATTCTTGCCTGG + Intronic
1135730375 16:24890167-24890189 AAGTGTAGATGATTTTAGGGAGG + Intronic
1137714088 16:50587185-50587207 ATGTGTATATGAATTGTGTGGGG + Intronic
1138384021 16:56623862-56623884 CTGTGTTGATGATGATTTTGTGG - Intergenic
1138388936 16:56656160-56656182 CTGTGTTGATGACATTTTTGTGG - Intronic
1138391441 16:56672976-56672998 CTGTGTTGATGACATTTTTGTGG - Intronic
1138842975 16:60531457-60531479 ATTAGTTGATGATTCTGGTGGGG - Intergenic
1139108977 16:63865147-63865169 ATTAGTTGATTATTTTCGTGTGG - Intergenic
1139194389 16:64902088-64902110 ATTTGTTCAAGATTTGTGTGAGG - Intergenic
1140313394 16:73870720-73870742 AAGTGTTGAAGTTTGTTGTGGGG + Intergenic
1140857649 16:78991928-78991950 ATGTGTTGAGAATTATTTTGTGG - Intronic
1141194262 16:81848172-81848194 ATCAGTTGATGATATTTGTGTGG - Intronic
1144237965 17:13280818-13280840 ATGTGTTAATGGTTTCTCTGAGG - Intergenic
1146462736 17:33059470-33059492 ATGAGTTCATGTCTTTTGTGGGG - Intronic
1146615401 17:34353132-34353154 ATGTTTTGATGAGTTGTGGGAGG + Intergenic
1147673466 17:42190002-42190024 ATGTGTTTAGAAGTTTTGTGTGG + Intronic
1148720671 17:49750866-49750888 ATGCTTTGTTGTTTTTTGTGGGG - Intronic
1149928065 17:60722437-60722459 ATGTGTTGATATCTTCTGTGAGG + Intronic
1150700776 17:67445035-67445057 AAGTGTGGATGATTTTAGGGAGG + Intronic
1150707848 17:67503694-67503716 AAGTGTGGATGATTTTAGGGAGG + Intronic
1150826013 17:68475959-68475981 ATGTGATGTTGATTTTTTGGGGG + Intergenic
1150856870 17:68761466-68761488 ATATTTTGATGAATTTTCTGGGG + Intergenic
1150876090 17:68971936-68971958 ATCTGTAGATTATTTCTGTGAGG - Intergenic
1152835574 17:82528407-82528429 ATCTGTTTAACATTTTTGTGGGG + Intronic
1153063826 18:1022272-1022294 GTGTGTTGATCATTTTTATGAGG + Intergenic
1153159445 18:2187223-2187245 ATGGCTTGATCATTTTTCTGTGG - Intergenic
1153491537 18:5654450-5654472 ATGTTATGATGATATCTGTGCGG + Intergenic
1153572932 18:6491591-6491613 ATGGGTTGATGTTTTTTTAGGGG - Intergenic
1153757082 18:8295037-8295059 ATGTGTTCATCATTTATGTTTGG - Intronic
1155113977 18:22746275-22746297 ATGTGTTTATGTATTTTCTGAGG - Intergenic
1156111350 18:33730888-33730910 ATGTATTGAATATTTTAGTGTGG + Intronic
1156894162 18:42225551-42225573 ATGATTTGATGGTTTTTGTGGGG + Intergenic
1157821156 18:50770648-50770670 ATTTGTTGAGAATTTTTTTGTGG - Intergenic
1157883991 18:51348656-51348678 ATATGTGGAGGATTTCTGTGGGG - Intergenic
1158193304 18:54855596-54855618 ATGTGTTGGGGATTTTAATGAGG - Intronic
1158608718 18:58919370-58919392 ATGTCTTAATGGTTTTTATGCGG - Exonic
1160057900 18:75502863-75502885 ATGTGTTTATCATTTCTTTGTGG - Intergenic
1160282520 18:77505119-77505141 ATCAGTTGACTATTTTTGTGTGG + Intergenic
1160523538 18:79522488-79522510 ATCTGCTGATGTGTTTTGTGTGG + Intronic
1160671817 19:368711-368733 ATGTGTCTGTGATTTTTATGGGG - Intronic
1161569058 19:5020229-5020251 AGGTGTTGTTGATGTTGGTGTGG + Intronic
1164655832 19:29920992-29921014 ATATGTAGATTATTTTTCTGAGG - Intergenic
926518465 2:13879628-13879650 ATGTGTTTATGATTTTCATGTGG + Intergenic
926561414 2:14421392-14421414 GTGTTTTGATGCTGTTTGTGTGG - Intergenic
927797758 2:26066138-26066160 ATGTGATGATGGTTTTTCTATGG + Intronic
928626105 2:33141692-33141714 AAGTGGTGATGAGTGTTGTGAGG + Intronic
928755579 2:34521718-34521740 ATGAGTTCATGTTTTTTGTAGGG + Intergenic
928803191 2:35119247-35119269 ATGTATTGTTGAATTTTGTTTGG - Intergenic
929065197 2:37965972-37965994 ATCTGCTGATGATTTTATTGAGG + Intronic
929266702 2:39926430-39926452 ATGTGTTGAGGATTTGTGACTGG - Intergenic
930477695 2:51904179-51904201 AAGCTTTGTTGATTTTTGTGGGG - Intergenic
930724846 2:54673038-54673060 ATGTTTTTTTGTTTTTTGTGGGG + Intergenic
931210052 2:60184596-60184618 AGGTGTAGATTTTTTTTGTGGGG - Intergenic
931548965 2:63421452-63421474 ATCAGTTGATTATATTTGTGTGG - Intronic
932034503 2:68229011-68229033 ATGTGTTTATGTTTTCTGGGGGG + Intronic
932827518 2:74955455-74955477 ATGCTTTTATGAATTTTGTGTGG + Intergenic
933012632 2:77087397-77087419 TTGATTTTATGATTTTTGTGTGG + Intronic
933086026 2:78054952-78054974 ATCTGTAGATGGCTTTTGTGAGG + Intergenic
933310562 2:80656428-80656450 ATCATTTGATGATATTTGTGAGG - Intergenic
934219370 2:90067754-90067776 AAGTGGTGATGGTTGTTGTGAGG + Intergenic
935388654 2:102527266-102527288 ATGTTTTTGTGATTTTTTTGTGG - Intronic
935532506 2:104252398-104252420 ATCTGTGGAAGGTTTTTGTGCGG - Intergenic
935716010 2:105939552-105939574 ATCTGTTGTTGATTATTGTCTGG - Intergenic
937636984 2:124167230-124167252 ATGTTTTAATGAATTATGTGTGG - Intronic
939429108 2:142080110-142080132 ATGTCTTGATGTTCTTTGTGGGG - Intronic
939744593 2:145952820-145952842 TTGATTTGATGAGTTTTGTGTGG + Intergenic
939997557 2:148934056-148934078 GTGTGTTTATGATGTATGTGAGG - Intronic
940101695 2:150047445-150047467 ATTGATTGATGATTATTGTGGGG - Intergenic
940152218 2:150615152-150615174 ATATGTTGCTGAATTTTGTTAGG + Intergenic
940670950 2:156667321-156667343 ATGAGTTGACAATATTTGTGTGG + Intergenic
941238975 2:163013501-163013523 TTTTATTGAGGATTTTTGTGTGG + Intergenic
941610478 2:167655400-167655422 ATTTGTGGTTGATTTGTGTGAGG - Intergenic
942101684 2:172590064-172590086 ATGTTTTGAAGATTTTTAAGTGG + Intronic
942152846 2:173094952-173094974 ATCTATTGATGATTCTTGTTTGG + Intronic
943782628 2:191841571-191841593 ATTTGTTAATTCTTTTTGTGGGG - Intronic
945467574 2:210187143-210187165 ATGCGTTCATGTTCTTTGTGGGG + Intergenic
945693007 2:213065480-213065502 ATGTGTATTTGATTTATGTGAGG - Intronic
946100654 2:217317716-217317738 CTGTGTAAATGAATTTTGTGTGG - Intronic
946150224 2:217760478-217760500 ATGTGTTTTTGTTTTTTGGGGGG - Intergenic
947837392 2:233185380-233185402 AAATGATGAGGATTTTTGTGCGG + Intronic
947883374 2:233542094-233542116 ATATTTTAATGATGTTTGTGGGG - Intronic
1169868757 20:10229246-10229268 TTGTGTTAAGGATTTTTGTTGGG + Intronic
1170565542 20:17601024-17601046 AAGAGTTGATGTTTTTTTTGTGG + Exonic
1171192418 20:23168326-23168348 ATGAGTTCATGATATTTGTAAGG - Intergenic
1177348576 21:19903940-19903962 ATCAGTTGATGATATTTGTATGG + Intergenic
1177375604 21:20267039-20267061 AAGTTTTGATGAGTTGTGTGAGG + Intergenic
1178576653 21:33798523-33798545 ATGTATTTAAGATTCTTGTGTGG + Intronic
1179404590 21:41114704-41114726 AGATGCTGATGATTTTTGAGTGG - Intergenic
1179480320 21:41672750-41672772 ATGTGTGTATGATGTGTGTGTGG - Intergenic
1180583148 22:16860382-16860404 ATGTCTTAATGGTTTTTATGCGG + Intergenic
1181995126 22:26872143-26872165 ATGTTTTGTAGATTTTAGTGTGG + Intergenic
1184085487 22:42260543-42260565 ATATGTATATGGTTTTTGTGAGG + Intronic
1185282541 22:49981018-49981040 ATTTGTTGATGTCTTTTGTCAGG - Intergenic
949300083 3:2573743-2573765 GTGTATTGATTGTTTTTGTGAGG + Intronic
949976002 3:9460054-9460076 TTATGTTGATTTTTTTTGTGGGG - Intronic
950774232 3:15335932-15335954 ATATGTTTATGATTGTTTTGTGG + Intronic
950834022 3:15902420-15902442 ATGTGTAGCTAATTTTTTTGGGG + Intergenic
951466429 3:23004844-23004866 ATTTGTTGAGGATATTTCTGTGG - Intergenic
951713915 3:25618098-25618120 TTGTGGTGGTGGTTTTTGTGAGG - Intronic
952206398 3:31185074-31185096 CTGCATTGATCATTTTTGTGAGG - Intergenic
953100569 3:39821817-39821839 ATTTGTTGATGCTTGTTTTGTGG + Intronic
953152997 3:40342395-40342417 ATCTGTTGATGCTTCTTATGAGG - Intergenic
953737927 3:45512187-45512209 ATGTACTGGTGATGTTTGTGGGG + Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
955896892 3:63709942-63709964 ATTTTTTGCTGATTTTTCTGGGG - Intergenic
956745109 3:72304930-72304952 ATATGTTGGCTATTTTTGTGTGG - Intergenic
957037031 3:75302918-75302940 ATGTGTTGATGCCTTATATGTGG - Intergenic
957979598 3:87491759-87491781 TTGTGTTGAGTATTTATGTGTGG - Intergenic
958591473 3:96163790-96163812 ATGTGTTTTTAATTTTTGTAGGG - Intergenic
959578581 3:107961454-107961476 ATCTGTTGTTGATTGTTGAGTGG - Intergenic
959655788 3:108803139-108803161 TTGAGTTGATTTTTTTTGTGTGG - Intergenic
960319111 3:116212668-116212690 AAGTTTTGATGATTTTTATAAGG - Intronic
960408262 3:117288658-117288680 ATGTGGGGATGATATTGGTGCGG - Intergenic
961984304 3:131116286-131116308 ATGTGTTCATGTTCTTTGTAGGG - Intronic
962048834 3:131790969-131790991 AAGTGTTAAAGATTTTTGTTTGG + Intronic
962142556 3:132805726-132805748 ATTTGTTGTTAATTTTTGTAGGG + Intergenic
962453589 3:135543880-135543902 ATACGTTGATTATTTTTGTAGGG + Intergenic
963573341 3:147026314-147026336 CTGTGTTTATGATTTTTGTTTGG - Intergenic
963734532 3:149004859-149004881 ATGGGCTGATGATGTTTGTAGGG + Intronic
963856503 3:150258993-150259015 ATGTCTGGCTAATTTTTGTGGGG + Intergenic
964008405 3:151859667-151859689 ATTTGTTCATGATAATTGTGTGG - Intergenic
964988864 3:162780956-162780978 TTTTGTTGGGGATTTTTGTGTGG - Intergenic
965168596 3:165229842-165229864 ATGAGTTGATTTTTTTTATGTGG + Intergenic
965988432 3:174785791-174785813 AAGTGTTTATGATTTTTGAATGG + Intronic
966333691 3:178843718-178843740 CTGTGTTACTGATATTTGTGTGG + Intergenic
966671686 3:182534002-182534024 ATATGTTGGTTATTGTTGTGTGG + Intergenic
967690990 3:192473373-192473395 ATGAGTTGATGGTTATTATGGGG + Intronic
967803148 3:193686963-193686985 ATGTGTTAGTGTTTTGTGTGTGG + Intronic
968228679 3:196991721-196991743 GAGTGTTGATGGTTTTGGTGGGG + Intronic
968692425 4:2000326-2000348 ATTTGTTGATATTTTTTGGGGGG - Intronic
969120560 4:4906653-4906675 ATGTGTTGGTGTATTTTCTGAGG - Intergenic
970183568 4:13424975-13424997 AAGTGTAGATGATTCTTCTGAGG - Intronic
970981054 4:22097799-22097821 CTCTGTGGATGATTTCTGTGAGG - Intergenic
971433683 4:26595755-26595777 ATGAGTTGGTGATGTTTATGTGG + Intronic
971639346 4:29110631-29110653 ATGTGTTTATGTTTCTTATGTGG + Intergenic
972161825 4:36236490-36236512 ATGTGTTTCTGATTTTTCAGTGG - Intronic
972663595 4:41142447-41142469 ATGTGTTGGTGGCTTTTGTTTGG + Intronic
973157407 4:46973877-46973899 GGTTTTTGATGATTTTTGTGGGG - Intronic
973300658 4:48579879-48579901 ATGTGTTTATCATTTATTTGTGG - Intronic
974294214 4:59974450-59974472 ATCTGTTGATGATTTTATTGTGG + Intergenic
974340777 4:60612840-60612862 ATGTCTTGATGATCTTTTTATGG - Intergenic
974844530 4:67335311-67335333 AAGTGTGGATGATTTTAGGGGGG + Intergenic
974867177 4:67595594-67595616 ATCTGTTGACCATTTTTGTACGG + Intronic
975810587 4:78164653-78164675 ATATGTTGATTATTTTAATGGGG + Intronic
975994550 4:80299260-80299282 ATGTATTTATCATTTTTTTGTGG + Intronic
977780991 4:100980762-100980784 ATGTCCTGCTAATTTTTGTGGGG + Intergenic
977902936 4:102443257-102443279 AAGTGTGGATGATTTTTGGAGGG - Intergenic
978039024 4:104035561-104035583 ATGTGGTCAGGATCTTTGTGTGG + Intergenic
978846957 4:113285199-113285221 CTGTGTTGATGATTGTTGTGTGG - Intronic
979169828 4:117586961-117586983 ATGTTTTGATTATTTTTAAGTGG + Intergenic
979687499 4:123526980-123527002 ATGGGTTGATGGTTTGTGAGAGG + Intergenic
980004900 4:127530695-127530717 ATGAGTTCATGTTCTTTGTGGGG - Intergenic
980515437 4:133851993-133852015 ATGAGATTTTGATTTTTGTGGGG - Intergenic
980535814 4:134120792-134120814 ATGTGTTTAGGGTTTGTGTGTGG + Intergenic
980647476 4:135661284-135661306 ATATTTTGTTGTTTTTTGTGTGG + Intergenic
980647793 4:135665744-135665766 ATCTTTTTCTGATTTTTGTGAGG - Intergenic
981036419 4:140174180-140174202 ATCAGTTGAGTATTTTTGTGTGG + Intergenic
981961322 4:150543033-150543055 ATGTGTTCTAGTTTTTTGTGGGG - Intronic
982144557 4:152370358-152370380 ATTTGTTTATGATTATTTTGTGG - Intronic
983312574 4:166083371-166083393 ATGTTTTGATCATATTTGTGGGG + Intronic
984071033 4:175112591-175112613 ATGTGTTGAGACTTTTTTTGTGG - Intergenic
984211671 4:176857252-176857274 ATGTGTTCATGGTTTGTGTAGGG + Intergenic
985076511 4:186220684-186220706 ATGTGTTGTTGAATTTAGTCTGG + Intronic
985124873 4:186683201-186683223 ATGTGTTAAGGATTTTTGCAGGG - Intronic
985326223 4:188773846-188773868 ATGTGTTGAGACTTTTTTTGTGG + Intergenic
985442174 4:189990129-189990151 ATGAGTTGATGTTCTTTGTAGGG - Intergenic
986154098 5:5156404-5156426 TTGTGCAGATGATTTTTGTAAGG - Intronic
986454870 5:7907430-7907452 ATTTGTTGATACTTTTTTTGTGG + Intergenic
986529726 5:8723813-8723835 AATTGTTGATGAGTTTTGGGTGG - Intergenic
986906969 5:12506602-12506624 ATGTTTTGTTGTTTTTTGAGTGG + Intergenic
987547065 5:19324544-19324566 ATTTTCTGATCATTTTTGTGTGG + Intergenic
987571835 5:19674123-19674145 ATGTGTTAGTGAATTTGGTGAGG + Intronic
988038996 5:25863686-25863708 AGGTGTTAATGTTGTTTGTGAGG + Intergenic
989289381 5:39745290-39745312 ATCTGTTATTGATTTTTTTGTGG - Intergenic
989431628 5:41361585-41361607 CTTTGTTCATGTTTTTTGTGGGG - Intronic
990102953 5:52215729-52215751 ATGAGTTCATGTTCTTTGTGGGG - Intergenic
990543783 5:56801880-56801902 ATGAGTTGATTATTTTTGAAGGG - Intergenic
990658950 5:57990882-57990904 TTGTTTTGATCAGTTTTGTGTGG + Intergenic
990691664 5:58370893-58370915 TTGTGTTGATGATCTTTCGGAGG - Intergenic
991224182 5:64250065-64250087 ATGTGTTGAGACTTGTTGTGTGG - Intronic
991509692 5:67363117-67363139 ATGTGTTGATGGTTTAGATGTGG - Intergenic
991555949 5:67895295-67895317 ATGAGTTCATGTTTTTTGTAGGG + Intergenic
992102285 5:73419341-73419363 ATTTGTAAATGATTTTTGTCAGG - Intergenic
992789524 5:80201107-80201129 ATTGATTGATGATTTTTTTGTGG - Intronic
993990886 5:94657434-94657456 ATGTGTTGAGATTTGTTGTGTGG + Intronic
994076543 5:95657362-95657384 ATGTGCTGCTGATTTTTGCATGG - Intronic
994700739 5:103131438-103131460 ATGTATTGAAGATATTTGGGGGG - Intronic
995279061 5:110311996-110312018 ATGTGTTTGTGATATTTCTGAGG - Intronic
995640007 5:114244710-114244732 TTGTGTTGGTGAAGTTTGTGAGG + Intergenic
996351572 5:122548495-122548517 ATTTATTAATGATTTTTGAGGGG + Intergenic
997060878 5:130501019-130501041 ATGAGTTGATGTCATTTGTGGGG - Intergenic
997135983 5:131326668-131326690 ATGTGTTCATGATGATTATGTGG + Intronic
998057316 5:139089232-139089254 ATGTGGTTATGATTTATGGGTGG - Intronic
999481511 5:151952483-151952505 ATGAGTTGATGATTGGTGAGAGG - Intergenic
999510059 5:152240795-152240817 ATGAGTTCATGTTTTTTGCGGGG + Intergenic
1000715730 5:164641866-164641888 ATGTGTTCATTTTTTTTGTATGG - Intergenic
1001251911 5:170153112-170153134 ATGTGTTTATGTGTCTTGTGTGG + Intergenic
1003237837 6:4313708-4313730 ATTTGTTTTTGGTTTTTGTGGGG + Intergenic
1003935774 6:10973731-10973753 ATGTGTTGAAGAGATTTCTGAGG + Intronic
1004832333 6:19490460-19490482 CTGTGTTGATTATTTTAGTAAGG + Intergenic
1005656264 6:27941341-27941363 ATGCTATGATGATTTTTTTGTGG - Intergenic
1006111318 6:31747379-31747401 ATCTGTTGAGGATTCCTGTGAGG - Exonic
1006282270 6:33063770-33063792 ATGAGTTCATGTTGTTTGTGGGG - Intergenic
1006427076 6:33972202-33972224 ATCTGTAGATGAGTTTTGAGAGG - Intergenic
1007028778 6:38606550-38606572 ATATTTTAATGCTTTTTGTGTGG - Intronic
1007665657 6:43511464-43511486 TTGTGTTGATAATTTTCCTGTGG - Intronic
1007912949 6:45534470-45534492 ATTTCATGATGATTTTTGAGAGG + Intronic
1008421472 6:51305382-51305404 ATGTGTTGTTTATTTTTCTGTGG + Intergenic
1009567667 6:65332373-65332395 ATATGTTGCTGAATTTGGTGTGG + Intronic
1009592551 6:65690893-65690915 ATGAGTTCATGTTCTTTGTGGGG - Intronic
1009608531 6:65906142-65906164 ATTTGCTGAGGATTGTTGTGTGG - Intergenic
1010478092 6:76314353-76314375 GTGTGTTGCTGCTTTTTGTGGGG + Intergenic
1010567768 6:77438115-77438137 ATTTCTTCATTATTTTTGTGGGG - Intergenic
1011392659 6:86871207-86871229 TTTTGTTGATGATTTTTGTGTGG - Intergenic
1012293403 6:97488296-97488318 ATGAGTTGATTATTTTTTTGTGG + Intergenic
1012920334 6:105215948-105215970 ATGGGTTGTGTATTTTTGTGAGG + Intergenic
1013745639 6:113342739-113342761 ATGTGTTGATGAGTTCAGTCTGG - Intergenic
1014052569 6:116972531-116972553 ATATATTTATCATTTTTGTGTGG + Intergenic
1014085084 6:117333028-117333050 ATGTGTTGATTTTTTTTGGAGGG - Intronic
1014101052 6:117512293-117512315 ATCTGTCACTGATTTTTGTGTGG + Intronic
1015441233 6:133249421-133249443 ATTTGTTCATGATTTTTATGAGG + Intronic
1015719994 6:136230952-136230974 TTTTGTTGTTGTTTTTTGTGAGG - Intergenic
1015729241 6:136331439-136331461 ATGTCTTGAGGATTTGAGTGGGG + Intergenic
1015764883 6:136705895-136705917 ATGTCTTGATTATCTGTGTGTGG - Intronic
1015794225 6:136994530-136994552 CTGTGTTAATGTTTTTGGTGTGG - Intergenic
1015830950 6:137368518-137368540 ATGTATTAATAATTTTTGGGGGG - Intergenic
1016134061 6:140516865-140516887 TTGAGTTGATGATTTTTGGTTGG - Intergenic
1016651640 6:146468529-146468551 ATTTTTTTCTGATTTTTGTGTGG - Intergenic
1017280638 6:152620603-152620625 ATGTGTTGATGAATTCGGTTTGG - Intronic
1017370825 6:153705553-153705575 ATATTTTGATGGTTTTTGTTGGG + Intergenic
1018428663 6:163705901-163705923 TTTTGTTGAAGATTTTTATGTGG - Intergenic
1018563291 6:165124527-165124549 ATGAGTTCATGTCTTTTGTGGGG + Intergenic
1018775462 6:167010630-167010652 ATGTGTAGAAGGTTTTTGAGGGG + Intronic
1020820641 7:12963348-12963370 ATTTGTAGCTGATTTTTTTGTGG + Intergenic
1020871486 7:13635586-13635608 ATGAATTGATGATGTATGTGTGG - Intergenic
1020898367 7:13971397-13971419 CTGTCTGGATGATTTTTGTATGG + Intronic
1021602711 7:22380150-22380172 ATGTATTTATGATTTATGTACGG - Intergenic
1022350024 7:29559425-29559447 ATGCATTGATGATTTGGGTGAGG - Intergenic
1022432259 7:30336763-30336785 ATGTTTTGATGTTTTCTGTGTGG + Intronic
1022645147 7:32222882-32222904 TTGTCCTGATGAATTTTGTGGGG - Intronic
1023200374 7:37690700-37690722 ATGTGTTGAGGATTGTTTTGTGG + Intronic
1023959326 7:44913396-44913418 AACTGTGGATGATTTTTGAGTGG - Intergenic
1024496283 7:50050443-50050465 ATCAGTTGAAGATATTTGTGTGG - Intronic
1025956175 7:66184879-66184901 GTGTGTTGGTGAGTTTTCTGAGG + Intergenic
1026024689 7:66734896-66734918 ATGTGGTGAGCAGTTTTGTGGGG - Intronic
1028021757 7:85785309-85785331 ATGTGTTGTTGAATTTGGTTTGG + Intergenic
1028027823 7:85868116-85868138 ATCTGATGATTATGTTTGTGGGG - Intergenic
1028242785 7:88441236-88441258 ATGGGTAGATGATTTTTATACGG - Intergenic
1028311711 7:89346294-89346316 AAATGTTTATCATTTTTGTGGGG - Intergenic
1028638127 7:93014024-93014046 ATTTGTTGATAATATTTGGGGGG - Intergenic
1029902193 7:104053288-104053310 ATGAGTTGATAATTTATGAGTGG + Intergenic
1033826864 7:145201676-145201698 ATCAGTTGATTATATTTGTGTGG + Intergenic
1034500863 7:151449703-151449725 ATGTGTTGATGACTTAGGTGAGG - Intergenic
1034998546 7:155593723-155593745 GTGATTTGATGCTTTTTGTGGGG - Intergenic
1039039296 8:33392170-33392192 ATGTGTGGTTGTGTTTTGTGTGG - Intronic
1039536571 8:38320757-38320779 ATGTTTTTATGATTTTTATTTGG - Intronic
1039671982 8:39612208-39612230 ATGTGTTGATCTTCTTTGTCTGG - Intronic
1041315416 8:56556976-56556998 ATTTTTTGAAGATTTTTGTCAGG + Intergenic
1041988331 8:63954171-63954193 ATGTATTGATGTTTACTGTGTGG + Intergenic
1043281049 8:78466635-78466657 ATTTGTTGAGGATTGTTTTGTGG - Intergenic
1044220959 8:89669217-89669239 ATGTGTTTATGCGTTTTTTGAGG - Intergenic
1044508902 8:93052596-93052618 ATGAGTTCATGTTCTTTGTGGGG - Intergenic
1045669522 8:104533301-104533323 CTGTTTTTATAATTTTTGTGTGG - Intronic
1045983158 8:108216151-108216173 ATGTGTTTATCCCTTTTGTGAGG - Intronic
1048322501 8:133411150-133411172 ATGTGTTGATGATGTTTGTTTGG + Intergenic
1050273849 9:3975790-3975812 ATTTCTTGATGTTTTCTGTGGGG - Intronic
1051139166 9:13959625-13959647 AAATGATGATGAGTTTTGTGAGG - Intergenic
1051452120 9:17208349-17208371 ATGTGTTGTTGAATTTGGTTTGG + Intronic
1051575409 9:18609716-18609738 GTGTGTTGATTATTTTAGGGGGG - Intronic
1052202347 9:25798585-25798607 AAGTGTGGATGATTTTCGCGGGG - Intergenic
1052487893 9:29126620-29126642 ATGTTTTCATGATTTATGTAGGG + Intergenic
1052622882 9:30936430-30936452 ATGTTTAGATGATTTTTGGGAGG + Intergenic
1055563014 9:77540362-77540384 ATGTGTTGAGGCTTGTTTTGTGG + Intronic
1056193062 9:84203876-84203898 ATGGGTTGATGATTTTGATTTGG + Intergenic
1058847503 9:108975502-108975524 AGCTGTTGTTGATTTTTGTCAGG - Intronic
1058850823 9:109010976-109010998 ATTTGTTGCTGTTTTTTGAGGGG - Intronic
1060440817 9:123637482-123637504 ACGTTTTGATGATTTTAGAGAGG - Intronic
1061190802 9:129081480-129081502 ATGGGTTGAGGATCTGTGTGAGG + Intronic
1186262254 X:7791890-7791912 ATGTGATGGAGATTTTTGTGTGG + Intergenic
1186519664 X:10194139-10194161 AGGTGTGGATGCTTTTGGTGAGG + Intronic
1187380017 X:18793475-18793497 ATTTGTTGAGGCTTTTTTTGTGG + Intronic
1188041080 X:25370130-25370152 ATGTGTTGAGGGTTTTCATGTGG + Intergenic
1188578794 X:31685411-31685433 ATGTGATGATGACATTTGAGTGG - Intronic
1188866375 X:35318076-35318098 ATGTTTTGCTGAGTTTTGTGGGG + Intergenic
1189179573 X:38990781-38990803 ATGTGTTTATCATTTATTTGCGG - Intergenic
1190136169 X:47800419-47800441 ATGTGTTCATGAATATTGAGTGG - Intergenic
1190587048 X:51955979-51956001 TTTTGTTGAAGATTTTTGTTAGG - Intergenic
1191577925 X:62727270-62727292 ATGTGTTGATTCTTTTCATGAGG - Intergenic
1191990412 X:67028841-67028863 ATGTTCTGTTGATTTTTGGGAGG - Intergenic
1192111225 X:68367050-68367072 ATGTGTTTTTGATGTTTCTGTGG - Intronic
1193165934 X:78280467-78280489 ATGTGTTGATTAACTTTGTTAGG - Intronic
1193865320 X:86723683-86723705 ATGTGTTGATATTTGTTCTGTGG + Intronic
1193989758 X:88291906-88291928 ATGTCTGGCTAATTTTTGTGGGG - Intergenic
1194109004 X:89808148-89808170 AGATGTTGATGATGTTGGTGAGG - Intergenic
1194178685 X:90686563-90686585 ATGTGTTGTTGAATTTGGTTTGG - Intergenic
1194550900 X:95297837-95297859 ATGTGTTGCTGGTTTTGGTTTGG - Intergenic
1194925681 X:99820328-99820350 ATGTGGTGTTGATTTTGGGGTGG - Intergenic
1196368078 X:114945431-114945453 ATGTGTGGAAGAATTTTGTAAGG - Intergenic
1198124767 X:133632023-133632045 ATGTGATAATGATTTTTTTCAGG + Intronic
1198629859 X:138624268-138624290 ATTTGTTGATCATATATGTGTGG - Intergenic
1199028480 X:142969141-142969163 ATGTGTTTATGTGTTTTGTGAGG - Intergenic
1199447544 X:147943566-147943588 GTGTGTTGATGATTTTCTTAAGG + Intronic
1199842068 X:151659560-151659582 ATTTGATGATGATTTTTGTTAGG + Intronic
1200461664 Y:3462882-3462904 AGATGTTGATGATGTTGGTGAGG - Intergenic
1200525353 Y:4268735-4268757 ATGTGTTGTTGAATTTGGTTTGG - Intergenic
1200815733 Y:7530302-7530324 ATTTCTTGATTATTATTGTGTGG + Intergenic
1201450500 Y:14107362-14107384 ATTTTTTGATGTTGTTTGTGAGG + Intergenic
1201888617 Y:18916541-18916563 ATGAGTTCATGTCTTTTGTGGGG + Intergenic
1202178694 Y:22120935-22120957 TTGTGTTATTTATTTTTGTGTGG - Intergenic
1202212667 Y:22465459-22465481 TTGTGTTATTTATTTTTGTGTGG + Intergenic