ID: 1106546091

View in Genome Browser
Species Human (GRCh38)
Location 13:30732202-30732224
Sequence CCTTCTAAAGCGCGAATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 24}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106546086_1106546091 -1 Left 1106546086 13:30732180-30732202 CCTCTCGCCAGGCGCCTTTCGAC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1106546091 13:30732202-30732224 CCTTCTAAAGCGCGAATGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 24
1106546087_1106546091 -8 Left 1106546087 13:30732187-30732209 CCAGGCGCCTTTCGACCTTCTAA 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1106546091 13:30732202-30732224 CCTTCTAAAGCGCGAATGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 24
1106546085_1106546091 5 Left 1106546085 13:30732174-30732196 CCGGCACCTCTCGCCAGGCGCCT 0: 1
1: 0
2: 2
3: 17
4: 272
Right 1106546091 13:30732202-30732224 CCTTCTAAAGCGCGAATGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 24
1106546081_1106546091 28 Left 1106546081 13:30732151-30732173 CCAAGGAGCTCAGAGCGGGGTGC 0: 1
1: 0
2: 2
3: 19
4: 177
Right 1106546091 13:30732202-30732224 CCTTCTAAAGCGCGAATGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 24
1106546084_1106546091 6 Left 1106546084 13:30732173-30732195 CCCGGCACCTCTCGCCAGGCGCC 0: 1
1: 0
2: 1
3: 74
4: 1002
Right 1106546091 13:30732202-30732224 CCTTCTAAAGCGCGAATGGCTGG 0: 1
1: 0
2: 0
3: 0
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106546091 Original CRISPR CCTTCTAAAGCGCGAATGGC TGG Intronic
901153916 1:7122907-7122929 ACTTCTAGAGGGAGAATGGCTGG - Intronic
906951074 1:50334826-50334848 CCTTCTAAGGCAGGAATCGCTGG + Intergenic
1080980849 11:37403696-37403718 CCTTCTAGAGCTAGAATGCCTGG - Intergenic
1083072477 11:59999937-59999959 CCTTCTAAAGCAGCAATGACAGG + Intergenic
1098577661 12:72061856-72061878 TCTTCTCAAGCTCGAATGGGAGG + Intronic
1106546091 13:30732202-30732224 CCTTCTAAAGCGCGAATGGCTGG + Intronic
1113223528 13:108133377-108133399 CATTCTAAACCAGGAATGGCAGG + Intergenic
1115515366 14:34179879-34179901 CCTGCTAAAGCCCCAAAGGCTGG + Intronic
1125386234 15:39140024-39140046 CCCTCTAAACTGGGAATGGCTGG + Intergenic
1145932240 17:28694173-28694195 CCCTCTAAAGCGCTGATGCCTGG - Intronic
1146245084 17:31273704-31273726 ACTTCCAAAGAGCAAATGGCAGG - Intronic
947234141 2:227922275-227922297 CCTGCTAAAGCACTAATGTCTGG + Intronic
1172411481 20:34726831-34726853 CCTTCCAAAGCTGGAATTGCAGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1181396197 22:22624211-22624233 CCTTCAAAAGTGAAAATGGCTGG - Intergenic
1181704328 22:24639801-24639823 CCTTCAAAAGTGAAAATGGCTGG - Intergenic
961741577 3:129036378-129036400 CCTTCTAAAGCAGGCATGCCAGG - Intronic
971492400 4:27226897-27226919 CCTTCTAAAGTGGGAGTGACAGG + Intergenic
993537206 5:89101625-89101647 CCTTCTCAAGGGTGAATGGAAGG - Intergenic
998720847 5:144946875-144946897 CCTTTTAAAACACAAATGGCTGG - Intergenic
1031910301 7:127509880-127509902 CCTCCCAAAGTGCTAATGGCAGG - Intergenic
1036085693 8:5610611-5610633 CCTTCGAAAGCACCAATGGGAGG + Intergenic
1058534380 9:105941901-105941923 CCTTCAAAAATGCAAATGGCAGG - Intergenic
1188905495 X:35786549-35786571 CCTTCTTCAGCGAGAATGGATGG + Intergenic
1195256116 X:103092881-103092903 CCATCTAAAGGGAGATTGGCTGG + Intronic