ID: 1106547005

View in Genome Browser
Species Human (GRCh38)
Location 13:30739365-30739387
Sequence CCTGCACCCAGGACACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 940
Summary {0: 1, 1: 2, 2: 10, 3: 141, 4: 786}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106546997_1106547005 13 Left 1106546997 13:30739329-30739351 CCTTCACTGTACCTATTTTGTTC 0: 1
1: 0
2: 2
3: 11
4: 207
Right 1106547005 13:30739365-30739387 CCTGCACCCAGGACACTGCCTGG 0: 1
1: 2
2: 10
3: 141
4: 786
1106547000_1106547005 -10 Left 1106547000 13:30739352-30739374 CCTGCTTTATTCCCCTGCACCCA 0: 1
1: 0
2: 1
3: 28
4: 228
Right 1106547005 13:30739365-30739387 CCTGCACCCAGGACACTGCCTGG 0: 1
1: 2
2: 10
3: 141
4: 786
1106546996_1106547005 18 Left 1106546996 13:30739324-30739346 CCTTTCCTTCACTGTACCTATTT 0: 1
1: 1
2: 1
3: 34
4: 397
Right 1106547005 13:30739365-30739387 CCTGCACCCAGGACACTGCCTGG 0: 1
1: 2
2: 10
3: 141
4: 786
1106546998_1106547005 2 Left 1106546998 13:30739340-30739362 CCTATTTTGTTCCCTGCTTTATT 0: 1
1: 0
2: 9
3: 82
4: 667
Right 1106547005 13:30739365-30739387 CCTGCACCCAGGACACTGCCTGG 0: 1
1: 2
2: 10
3: 141
4: 786
1106546999_1106547005 -9 Left 1106546999 13:30739351-30739373 CCCTGCTTTATTCCCCTGCACCC 0: 1
1: 0
2: 0
3: 28
4: 268
Right 1106547005 13:30739365-30739387 CCTGCACCCAGGACACTGCCTGG 0: 1
1: 2
2: 10
3: 141
4: 786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106547005 Original CRISPR CCTGCACCCAGGACACTGCC TGG Intronic
900120737 1:1047694-1047716 CCTGCACCCTGGACCCTTCCTGG + Intronic
900303239 1:1988444-1988466 GCTGCACCCATGTCACGGCCTGG + Intronic
900537343 1:3185440-3185462 CCTGCACTTAGGCCACAGCCTGG - Intronic
900601045 1:3502726-3502748 CCAGCACCCACGGCTCTGCCAGG - Intronic
900644058 1:3701006-3701028 CCTGGACCCTGGGCACTGTCTGG + Intronic
900653889 1:3745537-3745559 CCAGCCCCCAGGACGGTGCCCGG + Intergenic
900655174 1:3753254-3753276 CATTCACCCAGGAAGCTGCCAGG - Intronic
900782296 1:4626100-4626122 CCTGCACCCAGCCCTCCGCCTGG - Intergenic
900814415 1:4832445-4832467 CCAGCACCTAGAACAGTGCCTGG + Intergenic
901082866 1:6593331-6593353 CCTGCACCGAGGCCCGTGCCGGG + Exonic
901089114 1:6629683-6629705 CCCACACCCAGGACGCTGCCTGG + Intronic
901208046 1:7508573-7508595 CCAGCACCCAGCACTGTGCCTGG + Intronic
901731255 1:11281430-11281452 CTAGCACCCAGAGCACTGCCTGG + Intronic
902545805 1:17189731-17189753 CCAGCACCCAGCACAGGGCCTGG - Intergenic
902735295 1:18396770-18396792 CCAGCCCCCAGGAGACTTCCTGG + Intergenic
902796610 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG + Intergenic
903029056 1:20449626-20449648 CCTGCACCAAGAACAATGCCAGG + Intergenic
903145949 1:21372045-21372067 CCTTCTCCCAGGCCCCTGCCTGG + Intergenic
903381121 1:22897461-22897483 CCAGCACCTAGAACAGTGCCTGG - Intronic
903483643 1:23673263-23673285 TCAGCACCAAGGACAGTGCCCGG - Intergenic
903670378 1:25031765-25031787 CCTGAACCCAGCCCAGTGCCTGG - Intergenic
903995377 1:27302189-27302211 CCAGGACCCAGCACAGTGCCTGG - Intronic
904285914 1:29453201-29453223 ACAGCACCCAGCACAGTGCCTGG - Intergenic
904293587 1:29503398-29503420 TCGGTACCCAGGACAGTGCCTGG + Intergenic
904488565 1:30844097-30844119 ACTGCTCCCAGGAGACTCCCAGG - Intergenic
905210354 1:36369794-36369816 CCTGCACCCAGCCCACTGCCTGG + Intronic
905890775 1:41517018-41517040 CCAGCACCCAGAACAGAGCCAGG + Intronic
906283792 1:44572301-44572323 TCAGCACCCAGCACAGTGCCTGG + Intronic
906315918 1:44786383-44786405 CCTGCTCCCAGGACTCTCCCAGG + Intronic
906557167 1:46723074-46723096 CCGACACCCAGGCCCCTGCCTGG + Intergenic
906683384 1:47746659-47746681 CCTGCACTCAGGCCACTGTGTGG + Intergenic
906693278 1:47806996-47807018 CCAGCACCTAGAACAATGCCTGG - Intronic
907048826 1:51316164-51316186 CCAGCACCCAGCACACTGCCGGG + Intronic
907379764 1:54076757-54076779 CATGTATCCAGAACACTGCCTGG - Intronic
908213193 1:61922471-61922493 CTATCACCCAGAACACTGCCTGG + Intronic
908326803 1:63031011-63031033 CTAACACCCAGCACACTGCCTGG + Intergenic
908403647 1:63793560-63793582 CCAGCACCCAGCACTGTGCCTGG - Intronic
908419080 1:63942078-63942100 CCTGTGCCCAGCACCCTGCCTGG + Intronic
908763467 1:67533392-67533414 CCTGGACCTAGCACAATGCCTGG - Intergenic
909877060 1:80819965-80819987 CCAGCACCTAGAACAATGCCTGG + Intergenic
911443019 1:97953104-97953126 CCAGCACCTAGTACAGTGCCTGG + Intergenic
911696250 1:100893541-100893563 CCAGCACCCAGCACAGAGCCTGG + Intronic
911881191 1:103240134-103240156 GCTGCATCCAGAACAATGCCTGG + Intergenic
912159620 1:106966033-106966055 TCAGCACCCAGCACAGTGCCTGG + Intergenic
912330222 1:108813442-108813464 TGTGCACCCTGGAGACTGCCAGG + Intergenic
912490226 1:110058697-110058719 CTGGCACCCAGCACATTGCCAGG + Intronic
912513832 1:110206053-110206075 TCTGCAGCCAGGACTGTGCCTGG - Intergenic
912558370 1:110532354-110532376 CCAGCACCCAGCACAGTGCCAGG - Intergenic
913149127 1:116022865-116022887 CCTGCACCCAGGACAAAGTAAGG + Intronic
913548445 1:119893381-119893403 CCTTGCCCCAGGACACTGCCAGG + Intergenic
915280068 1:154816479-154816501 CCTACATCCAGGCCAATGCCGGG - Intronic
915705835 1:157842770-157842792 CCTCCACCCATCACATTGCCTGG - Intronic
917170340 1:172165930-172165952 CAAGCACCCAGCACAGTGCCTGG - Intronic
918043460 1:180927152-180927174 CTGTCACCCAGGAAACTGCCTGG + Intronic
918060190 1:181054275-181054297 CCAGCAACCAGTACAGTGCCTGG - Intronic
918163920 1:181926334-181926356 CCTGCACCTAGAACAATGCCTGG + Intergenic
918363809 1:183785583-183785605 CCAGCACCCAGCACAGTACCTGG + Intronic
919106397 1:193156863-193156885 CCAGCACTCAGCACACTGCCAGG - Intronic
919921955 1:202171410-202171432 CCTGGGCCCAGGCCAGTGCCTGG + Intergenic
920259848 1:204681631-204681653 CCTGCACCTAGCACAGAGCCAGG + Intronic
920295975 1:204956663-204956685 CCAGCACCTAGCACAGTGCCTGG + Intronic
920376659 1:205512384-205512406 CCAGGGCCCAGGACAGTGCCTGG + Intronic
920505198 1:206510781-206510803 CTTGCACCCAGCAGAGTGCCAGG + Intronic
920566614 1:206979208-206979230 CCAGCACCCAGCAAAGTGCCTGG - Intergenic
920959055 1:210648056-210648078 CCAGCACCCAGGAAAGGGCCAGG - Intronic
921367276 1:214385251-214385273 CCTTCACCCAGGGGACTGCAGGG + Intronic
921677082 1:217988428-217988450 TCTGCACACAGCACAGTGCCTGG - Intergenic
922043054 1:221915917-221915939 TCAGCACCCAAGACAATGCCTGG + Intergenic
922109247 1:222541483-222541505 CCAGCACTCAGGACAGTGCCTGG - Intronic
922469036 1:225864247-225864269 CCAGCACCTAGAACAGTGCCTGG - Intronic
922562742 1:226580801-226580823 CCAGCACCAAGGACAGTGTCTGG + Intronic
922765208 1:228152837-228152859 CCACCAGCCAGGACGCTGCCTGG - Intronic
922766756 1:228160085-228160107 CCTGCCCCCGGCACGCTGCCTGG - Intergenic
922909541 1:229204211-229204233 CCTGCACACAGGCCCCTGTCGGG - Intergenic
922987413 1:229876836-229876858 CCAGGACCCAGGACTCTGGCTGG - Intergenic
923204096 1:231741488-231741510 CCTGCACCTGGGATGCTGCCTGG - Intronic
923247028 1:232142628-232142650 CATGTACCCAGGACACTGCCAGG + Intergenic
923999500 1:239534976-239534998 CCAGCACCTAGCACAGTGCCTGG - Intronic
924090543 1:240496675-240496697 CCTGCTCTCAGAACAGTGCCTGG + Intronic
924335428 1:242982524-242982546 CCAGCACCTAGAACAGTGCCTGG + Intergenic
924799152 1:247314710-247314732 CAGGCACCCAGGACACGGCTGGG + Intronic
1062782015 10:221334-221356 CCTGCAAACTGGGCACTGCCAGG - Exonic
1062795042 10:338787-338809 CCTGCACGCTGCACCCTGCCTGG + Intronic
1062795064 10:338876-338898 CCTGCACCCTGCACCCTGCCTGG + Intronic
1062795076 10:338917-338939 CCTGCACCCTGCACCCTGCCTGG + Intronic
1063217838 10:3939809-3939831 CTTGAACCCAGGAGACAGCCTGG - Intergenic
1064290586 10:14030709-14030731 CCTGATCCCAGGCCAGTGCCAGG - Intronic
1064330898 10:14392949-14392971 CCTGCACCCAGGTCAGTTGCTGG - Intronic
1065136570 10:22676719-22676741 TCAGCACCCAGAACAGTGCCTGG - Intronic
1065334534 10:24642856-24642878 CCAGCACACAGAACACTGCATGG + Intronic
1067088294 10:43254177-43254199 CCTGGAGCCAGGACACTTCAGGG + Intronic
1068671063 10:59724107-59724129 CCTGTACCTACAACACTGCCAGG + Intronic
1069571590 10:69497677-69497699 CCAGTGCCCAGGACAATGCCAGG + Intronic
1069722190 10:70556921-70556943 CCTGACTCCAGGACCCTGCCTGG + Intronic
1069749555 10:70736564-70736586 CAGGCACCCAGGGCACTGCAGGG - Intronic
1069844072 10:71358549-71358571 CCAGCATCCTGTACACTGCCTGG + Intronic
1069930941 10:71881138-71881160 TGTGCACCCAGGACTCTGCCTGG - Intergenic
1070280547 10:75045033-75045055 TCAGCACCCAGCACAGTGCCTGG - Intronic
1070533729 10:77359854-77359876 CCAGCACCTAGAACAGTGCCTGG + Intronic
1070731538 10:78831867-78831889 CCTGTTCCCAGCACAGTGCCTGG - Intergenic
1070812420 10:79305210-79305232 CTTGCACACAGGACACCTCCAGG - Exonic
1070935199 10:80288644-80288666 CCTGCACCCTGGTCACTGCTGGG - Intronic
1071470436 10:85980287-85980309 CCTACTCCTAGGACAGTGCCTGG + Intronic
1071470824 10:85983108-85983130 CCTGGACACAGGTCTCTGCCGGG + Intronic
1071515451 10:86293828-86293850 AATGCACCCAGCACAGTGCCTGG - Intronic
1071522331 10:86339110-86339132 CCAGCACCCAACACAGTGCCTGG + Intronic
1072618704 10:97066212-97066234 CCAGCACCTAGGACAGTGCCTGG + Intronic
1072619109 10:97068082-97068104 CCAGCACCTAGGACAGTGCCTGG + Intronic
1073205415 10:101766845-101766867 CCCTCACCCAGGACAGAGCCTGG + Intergenic
1073254867 10:102144463-102144485 TCACCACCCAAGACACTGCCCGG - Intronic
1073786288 10:106893469-106893491 TCTGCACCTAGCACAATGCCTGG + Intronic
1074373355 10:112918726-112918748 CCTGTGCCCACGACACTGCCTGG - Intergenic
1074529997 10:114290527-114290549 CCTGCACTGAGAACAATGCCTGG - Intronic
1074738423 10:116460163-116460185 TCTGCACGGAGGACACTGACTGG + Intronic
1074949227 10:118312835-118312857 CCAGCACCTAGAACAGTGCCTGG - Intronic
1075087601 10:119423942-119423964 CCAGCACCCAGCACAGTGCCAGG - Intronic
1075103891 10:119524554-119524576 CCAGCACCGAGGACAGGGCCTGG - Intronic
1075619811 10:123917875-123917897 CCAGCAGCCAGGACAATGTCTGG - Intronic
1075655052 10:124155861-124155883 CGAGCAGCCAGGCCACTGCCCGG + Intergenic
1075784154 10:125037333-125037355 CCTGCACCCAGGATTCTCCAGGG - Intronic
1076401911 10:130190374-130190396 CCTGGACCCAGCACACGGCGGGG - Intergenic
1076426743 10:130372429-130372451 CCAGCACCAAGGACACAGGCTGG - Intergenic
1076480465 10:130781889-130781911 CCAGCACCCAGAACATTGCCAGG + Intergenic
1076726769 10:132417477-132417499 GCTGCCTCCAGGACACTGCGAGG - Exonic
1077229663 11:1453032-1453054 GCTGCAACCTGGAAACTGCCTGG - Intronic
1077236479 11:1484323-1484345 CCTGCACCCCACACGCTGCCTGG - Intronic
1077297912 11:1834690-1834712 CCTGGACCCTGGGCCCTGCCTGG - Intronic
1077474105 11:2778365-2778387 CCTCCACTCAGGACACAGCCAGG - Intronic
1077594564 11:3520656-3520678 CCACCACCCAGCACAGTGCCTGG + Intergenic
1077962974 11:7095031-7095053 ACAGCACCCAGCACAGTGCCTGG + Intergenic
1078322670 11:10350792-10350814 CCTGCACCCAAAACAGTGCTGGG + Intronic
1078466363 11:11553377-11553399 ACTGGAACCAAGACACTGCCAGG + Intronic
1078489224 11:11753953-11753975 CCTGCACCCTGGCCACAGCACGG - Intergenic
1078738987 11:14048996-14049018 AGTGCACCCAGAACAGTGCCTGG - Intronic
1079103045 11:17553236-17553258 CCTGCACCCAGGTCCCTTCCTGG - Intronic
1079114664 11:17633768-17633790 TCTGGACCCAGAGCACTGCCAGG + Exonic
1079203805 11:18396458-18396480 CCTACAGCAAGGACACAGCCAGG - Exonic
1079451046 11:20599914-20599936 TCAGCACCGAGGACAGTGCCCGG - Intronic
1079522735 11:21347805-21347827 CTGGCTCCCAGGACTCTGCCTGG - Intronic
1080681767 11:34483402-34483424 GCAGCACCTAGCACACTGCCGGG + Intronic
1081484563 11:43517549-43517571 CCAGCACCCAGCATAGTGCCTGG - Intergenic
1081537311 11:44005208-44005230 CCTGCCCCCAGCCCCCTGCCTGG + Intergenic
1081582855 11:44364589-44364611 CCAGCACCCAGGATAGGGCCTGG - Intergenic
1081633029 11:44702206-44702228 TCAGCACCCAGAACAGTGCCTGG + Intergenic
1081651663 11:44827917-44827939 CCTGCGCCCTGGACTCTCCCAGG - Intronic
1081703541 11:45166627-45166649 CTAGCACCTAGGACAGTGCCTGG + Intronic
1081739951 11:45431861-45431883 CTTGAACCCAGGCCACTGCCAGG + Intergenic
1081840683 11:46199290-46199312 CCAGTACCTAGGACGCTGCCTGG - Intergenic
1081995290 11:47359811-47359833 CCGTCCCCCAGGAGACTGCCAGG - Intronic
1082090307 11:48083703-48083725 CCAGCACCCAGGACAGTGTCTGG + Intronic
1083272771 11:61580585-61580607 CCCGCAGTCTGGACACTGCCAGG - Intronic
1083721487 11:64605835-64605857 CCCGCACCCAGGTCTGTGCCCGG + Intergenic
1083932155 11:65851966-65851988 CCAGCTGCCAGCACACTGCCCGG + Intronic
1084149158 11:67280120-67280142 CCTGGAGCTAGGAGACTGCCTGG - Intronic
1084198720 11:67541346-67541368 CCTGCCCCAAGGAGCCTGCCAGG + Intergenic
1084439881 11:69166781-69166803 CCTGCCGCCAGCACACTGCTGGG - Intergenic
1084475699 11:69387401-69387423 CCAGCACCTAGCACAGTGCCTGG + Intergenic
1084500067 11:69530187-69530209 TTTGAACCCAGGACGCTGCCAGG + Intergenic
1084748503 11:71188747-71188769 CCAGCACCCAGCACAGTGCAGGG - Intronic
1085033576 11:73287187-73287209 CCGTCGCCCAGGACAATGCCTGG + Intronic
1085045136 11:73348272-73348294 CCTGCACAGAGAACACTACCTGG - Intronic
1085154848 11:74284012-74284034 CCAGCACCCAGGCCAGTGTCTGG + Intronic
1085202705 11:74711354-74711376 CCAGCACCTAGAACAGTGCCTGG - Intronic
1085287879 11:75375824-75375846 CCAGCACCCAGCGCAGTGCCTGG + Intergenic
1085384530 11:76149593-76149615 CCTGCCCTCAGGAAGCTGCCAGG + Intergenic
1085472786 11:76768795-76768817 CCTGCACCTAGAGCAGTGCCTGG - Intergenic
1085515315 11:77108194-77108216 CCAGCACCCAGCACAGGGCCTGG - Intronic
1085717935 11:78889617-78889639 TCTGCACCCCTGACACTGCAAGG - Intronic
1085833352 11:79926957-79926979 CCTGCAGCCAGCACAGTACCTGG - Intergenic
1085834381 11:79936737-79936759 CCAGGTCCCAGGACACTGCCCGG + Intergenic
1086421673 11:86643758-86643780 CATGAACCCAGCACAGTGCCTGG + Intronic
1087043239 11:93821836-93821858 CCTGAACCCAGTACAATGCCTGG + Intronic
1087588322 11:100151313-100151335 CCAGTACCTAGGACAATGCCTGG - Intronic
1087716088 11:101610585-101610607 CCTGGACCTAGCACACTGCCTGG - Intronic
1088086081 11:105982031-105982053 CCAGCACCCAGCACAGTGCCTGG + Exonic
1088305811 11:108406195-108406217 CCTGCATCCAGAACAATGTCTGG + Intronic
1088668626 11:112119606-112119628 CCAGGACCCAGCACAGTGCCTGG - Intronic
1088909601 11:114180715-114180737 TCTGCACCCAGGAACCTGCCTGG + Intronic
1089385687 11:118066084-118066106 CCTCCACCCAGGGCTCTCCCTGG + Intergenic
1089691842 11:120191710-120191732 CCGACACCCAGGACAGTGCCTGG - Intergenic
1089788314 11:120923904-120923926 CATCCACCCAGCACACTGTCAGG + Intronic
1089789457 11:120932262-120932284 CCAGCACCTTGCACACTGCCTGG + Intronic
1090313526 11:125764521-125764543 CCTGCAGCCACCCCACTGCCAGG - Intergenic
1090454984 11:126841402-126841424 CCAGCAGCCAGCACAATGCCAGG + Intronic
1091262809 11:134247180-134247202 CCTGAACACAGGACACAGCGTGG - Exonic
1091555693 12:1571887-1571909 CCTGCACCCAGGAAAGTGCTGGG - Intronic
1091702759 12:2674661-2674683 CCCGCACCTTGGCCACTGCCTGG + Intronic
1091742657 12:2971078-2971100 GCTGCACCTAGCACAGTGCCGGG - Intronic
1092036862 12:5343706-5343728 CTTGTACCTAGGACACTGGCTGG - Intergenic
1092238317 12:6823021-6823043 CCTGCATCCAGGAGACCGGCAGG + Intronic
1092420738 12:8329445-8329467 CCACCACCCAGCACAGTGCCTGG + Intergenic
1096463142 12:51833885-51833907 CAAGCACCTAGGACAGTGCCCGG + Intergenic
1096801249 12:54112121-54112143 TCAGCACCCAGCACAGTGCCTGG - Intergenic
1097178772 12:57158912-57158934 GCTGCACACAGCACACAGCCAGG + Intronic
1097330075 12:58323454-58323476 TCAGCACCCAGAACAGTGCCTGG + Intergenic
1098298395 12:69028129-69028151 CCAGCACCCAGTGCAGTGCCAGG - Intergenic
1098386274 12:69922115-69922137 CCTGCACCCTGCTCACTGGCAGG - Intronic
1099362154 12:81717667-81717689 CTAGCACCCAGGACAGTGCCTGG - Intronic
1099887318 12:88547873-88547895 CTAGCACCTAGGACAATGCCTGG - Intronic
1100241940 12:92718468-92718490 CCGGTACCTAGAACACTGCCTGG + Intergenic
1100394822 12:94175757-94175779 TCAGCACCCAGAACAGTGCCTGG - Intronic
1100511661 12:95280740-95280762 TCTGCACCTAGAACAGTGCCTGG + Intronic
1101019519 12:100539390-100539412 CCAGCACCTTGGACAGTGCCTGG - Intronic
1101194930 12:102372062-102372084 CCAGCACCTAGCACAGTGCCTGG - Intergenic
1101237795 12:102806781-102806803 TCAGCACCTAGGACAGTGCCTGG + Intergenic
1101344412 12:103872902-103872924 ACTCCCCCCAGGACTCTGCCTGG - Intergenic
1101440811 12:104703151-104703173 CCTGCACCTAGCACAGTGCCTGG + Intronic
1101547786 12:105732854-105732876 CCAGCACCTAGAACAGTGCCTGG + Intergenic
1101571418 12:105957301-105957323 TCCACCCCCAGGACACTGCCAGG + Intergenic
1101649024 12:106658079-106658101 CCTACACCCAGAACAATGCCTGG + Intronic
1101876980 12:108602636-108602658 TCGCCACCCAGGACAGTGCCTGG + Intergenic
1101933315 12:109033722-109033744 CCTGCTCCCAGCACAGTGCCAGG - Intronic
1102001621 12:109561198-109561220 CCTGGAGGCAGAACACTGCCCGG - Intronic
1102214835 12:111153275-111153297 CCAGCACCTAGAACAGTGCCTGG - Intronic
1103039602 12:117684338-117684360 CCAGCACCCAGCACAAAGCCTGG + Intronic
1103508417 12:121456647-121456669 CCTGCCCCGAGGACAGTGTCTGG + Intronic
1103861011 12:124014000-124014022 CCAGCACCTAGCACAGTGCCTGG - Exonic
1104091403 12:125520809-125520831 CCTGCACCTAGCACAATGGCTGG + Intronic
1104559687 12:129832636-129832658 CCTCCTCCCAGGCCTCTGCCCGG + Intronic
1104702308 12:130916272-130916294 CCGGCACGCAGGACCCGGCCGGG + Intergenic
1105817497 13:24050567-24050589 GCAGCACCCAGGACACAGCATGG + Intronic
1105847726 13:24307983-24308005 CCTCCCGCCAGGACCCTGCCGGG - Intronic
1105949652 13:25218146-25218168 CTGGTACCCAGGACAGTGCCTGG - Intergenic
1106547005 13:30739365-30739387 CCTGCACCCAGGACACTGCCTGG + Intronic
1106581583 13:31023357-31023379 CCAGCACCCATCACAATGCCTGG - Intergenic
1107451520 13:40514510-40514532 CCTGCCCCCAAGTCACTGTCAGG + Intergenic
1107669160 13:42725916-42725938 CCAGCACCCAGCACCCTACCTGG + Intergenic
1109357260 13:61247261-61247283 CCTACACCCAGAACACTGAATGG - Intergenic
1111034516 13:82655361-82655383 CCTGCACTCAGTTCACTCCCTGG + Intergenic
1111086769 13:83385853-83385875 CCTGCACCCAGGACATAACTTGG - Intergenic
1112660978 13:101507283-101507305 CCGGCACCAAGGACAGTGCTTGG + Intronic
1113135927 13:107089713-107089735 CCTGTACCCAGGCCAGTGCCTGG - Intergenic
1113505240 13:110812182-110812204 ACTGCACGCATGACAGTGCCAGG + Intergenic
1113600376 13:111564013-111564035 CTGGCACCCAGGACTGTGCCGGG + Intergenic
1113812317 13:113150150-113150172 CCTGCATCCAGGCCACAGCCTGG + Intergenic
1114069858 14:19098000-19098022 GCTGCAGCCAGGAGACTCCCGGG + Intergenic
1114092404 14:19302002-19302024 GCTGCAGCCAGGAGACTCCCGGG - Intergenic
1114405640 14:22453573-22453595 CTGGCACCCAGAACAGTGCCTGG - Intergenic
1114610641 14:24037824-24037846 CCTGCAGCGTGGCCACTGCCTGG - Intergenic
1114862306 14:26539185-26539207 CCAGCATGCAGGACAGTGCCGGG + Intronic
1115887277 14:37986622-37986644 AATGCACGAAGGACACTGCCTGG + Intronic
1116000989 14:39242673-39242695 CCAGCACCTAGCACAGTGCCAGG + Intronic
1117457918 14:55916211-55916233 TCAGCAACCAGGACAGTGCCTGG + Intergenic
1117504712 14:56390639-56390661 CCTGCACCCAGCTCTCTTCCTGG + Intergenic
1117527513 14:56624602-56624624 TCTGCACCTAGCACACTGCCTGG - Intronic
1117829940 14:59740187-59740209 CTTGCACCCAGCACAGTGCCTGG + Intronic
1118650254 14:67883814-67883836 TCAGCACCCAGAACAGTGCCTGG + Intronic
1119405333 14:74395255-74395277 CCTGCTCCCAGGAGTCTACCTGG - Intergenic
1119640733 14:76312924-76312946 CCTGCACACTGGAGCCTGCCTGG + Intronic
1119683602 14:76612199-76612221 CCCTCATCCAGTACACTGCCCGG - Intergenic
1119695254 14:76708394-76708416 CCAGCACCCAGCACAGGGCCTGG + Intergenic
1119791999 14:77359313-77359335 CCTGCACTCAGGACCCTTCCAGG + Intronic
1119810798 14:77517475-77517497 CCAGCACCCACCACACTGCCAGG - Intronic
1119849933 14:77860058-77860080 CCAGCACCTAGCACCCTGCCTGG - Intronic
1119905027 14:78293891-78293913 GAAGCAACCAGGACACTGCCAGG - Intronic
1121249732 14:92490528-92490550 ACAGCACCCACGACCCTGCCTGG - Intronic
1121409744 14:93741522-93741544 CCAGATCCCAGCACACTGCCAGG - Intronic
1121555551 14:94833926-94833948 CCTGCCCCCAGAAGTCTGCCCGG - Intergenic
1121588010 14:95077111-95077133 CCTGTACCAAGGACACTGAAAGG - Intergenic
1121718639 14:96094149-96094171 CCACCACCCAGCACAGTGCCTGG + Intergenic
1122201904 14:100127941-100127963 CCAGCACCTAGCACAGTGCCTGG + Intronic
1122322997 14:100866764-100866786 CCAGCACCCAGGCCACAGACAGG - Intergenic
1122436974 14:101706953-101706975 CCAGCACCCAGCACAGTGCCTGG + Intergenic
1122456276 14:101854643-101854665 GCCGCCCCCAGGACACTCCCTGG + Intronic
1122546862 14:102527906-102527928 CCTTTCCCCAGGATACTGCCTGG - Intergenic
1122680075 14:103453286-103453308 CCTGCCTCTAGCACACTGCCTGG + Intronic
1123438080 15:20270219-20270241 CTGGCACCCAGCACAGTGCCAGG + Intergenic
1123693085 15:22855497-22855519 CCAGCACCTAGAACAATGCCTGG - Intronic
1123998518 15:25735098-25735120 CCTCCAAGCAGGACAGTGCCAGG + Intronic
1124067161 15:26355065-26355087 CCTGCCTGCAGGTCACTGCCTGG - Intergenic
1124469956 15:29975508-29975530 CCTGCACCCAGAACAGTGCCTGG + Intergenic
1124602538 15:31147212-31147234 CCAGCTCCAAGAACACTGCCTGG + Intronic
1126075374 15:44904040-44904062 ACAGCACCCAGCACAGTGCCTGG - Intergenic
1126082996 15:44983747-44983769 ACAGCACCCAGCACAGTGCCTGG + Intergenic
1126279020 15:46921043-46921065 CCAGCAAACAGCACACTGCCTGG + Intergenic
1126476537 15:49070785-49070807 CCTGAATACAGGACACTGACGGG - Intergenic
1127094071 15:55495446-55495468 ACTGCACCCAGACTACTGCCTGG - Intronic
1127636357 15:60874330-60874352 CCAGCACCTAGAACAGTGCCTGG - Intronic
1127636440 15:60875191-60875213 CCAGCACCTAGAACAGTGCCTGG + Intronic
1128323003 15:66705677-66705699 ACAGCACCCAGCACAGTGCCTGG - Intronic
1128495457 15:68195927-68195949 ACTCCCCCCAGGACACTGCCCGG - Intronic
1129007774 15:72388600-72388622 CCAGCACCTAGCACAGTGCCAGG + Intergenic
1129156978 15:73724292-73724314 CCAACACACAGGACAGTGCCAGG - Intergenic
1129238378 15:74237242-74237264 CCAGCACTCAGAACAGTGCCTGG + Intronic
1129266091 15:74393955-74393977 CCAGCTCCCAGGACAGTACCTGG + Intergenic
1129599619 15:76991002-76991024 CCTGCACTCAGGTCTCTGCTGGG - Intergenic
1129713451 15:77833318-77833340 CGGGCACCCAGCACACTGCCAGG + Intergenic
1130718972 15:86367454-86367476 CCTGCCCCCAGCAGACTGACTGG - Intronic
1130957244 15:88636414-88636436 CCAGCACCTAGAACCCTGCCTGG - Intronic
1131119743 15:89814793-89814815 CCTGGACCCTGGACCCTGGCGGG + Exonic
1132147982 15:99439701-99439723 CCAGCAGCCATGACACCGCCCGG - Intergenic
1132224750 15:100131859-100131881 CCTGCACCCTGGACCTTGGCTGG + Intronic
1132352310 15:101147594-101147616 CCTGCACCCAGGACAATTATGGG + Intergenic
1132696553 16:1204741-1204763 CCTGCTCCCAGATCAGTGCCGGG + Intronic
1132837008 16:1959228-1959250 GCTGCACTCAGCACAGTGCCTGG + Intergenic
1132861468 16:2073773-2073795 GCTGTTCCCGGGACACTGCCTGG + Intronic
1132879607 16:2156138-2156160 CCGGCGCCCAGAACAGTGCCTGG - Intronic
1133026078 16:2989531-2989553 CCTGCTCCCAGGCCACTGTGGGG - Intergenic
1133359456 16:5162491-5162513 CCAGCACCCAGCACAGTGCCTGG + Intergenic
1133613836 16:7457302-7457324 CCAGCACCCAGGACACAGATCGG - Intronic
1134053791 16:11156520-11156542 ACAGCACCCAGGAGACTCCCAGG - Intronic
1134058324 16:11183630-11183652 CCTGCAGTCCTGACACTGCCTGG + Intergenic
1134092140 16:11397153-11397175 CCTGCACCTAGAACACAGCCTGG + Intronic
1134193339 16:12139409-12139431 CTTGCACCTAGCACAGTGCCTGG + Intronic
1134308393 16:13054159-13054181 CCTGCACCTAGAACCATGCCTGG + Intronic
1134640898 16:15828488-15828510 CCTGCACCCCGCACAGTGCCAGG + Intronic
1134688516 16:16175413-16175435 CCTCCAGCCAGGACACAGCTGGG - Intronic
1135033744 16:19059532-19059554 CATTTACCCAGGACACTGCAAGG + Intronic
1135082734 16:19450325-19450347 CCAGCACCTAGTACAGTGCCTGG + Intronic
1135188095 16:20332243-20332265 CCAGCACCTAGAACAGTGCCTGG + Intergenic
1135400448 16:22162995-22163017 CCAGCACCTAGAACAGTGCCTGG - Intergenic
1135470687 16:22727429-22727451 CCAGCACTCAGCACAATGCCTGG + Intergenic
1135522042 16:23185055-23185077 CCTGCACCCAGCGTACTACCAGG + Intronic
1135829862 16:25763513-25763535 CCAGCACCCATCACAGTGCCTGG - Intronic
1135916217 16:26607838-26607860 CCTGTACCCAGGAAACTGAGGGG - Intergenic
1136846498 16:33580633-33580655 CTGGCACCCAGCACAGTGCCAGG - Intergenic
1137404438 16:48178657-48178679 CCAGCTTCCAGGCCACTGCCCGG - Exonic
1137497982 16:48985636-48985658 CCAGCACCTAGAACACTGCTTGG - Intergenic
1137589725 16:49686194-49686216 CCAGCACTCAGCACACAGCCTGG + Intronic
1137630050 16:49936842-49936864 CCAACACCCAGCACAGTGCCTGG - Intergenic
1138269019 16:55681363-55681385 CCAGCCCCCGGCACACTGCCTGG + Intronic
1138341241 16:56290358-56290380 CCAGCACCCAGCACAGTGCCTGG + Intronic
1138607572 16:58098751-58098773 CCTGCCCCCAGGACAGTGCCTGG - Intergenic
1138627559 16:58264640-58264662 CCAGCATCAAGGACAGTGCCTGG + Intronic
1139363165 16:66416071-66416093 CCTGTGCCCAGCACAGTGCCTGG + Intergenic
1139471922 16:67182967-67182989 CCAGAACCCAGAACAGTGCCTGG + Intronic
1139667606 16:68468802-68468824 CCTGCACCCAGACCCATGCCAGG + Intergenic
1139673160 16:68505427-68505449 CCAGCACCAAGGACACCGACTGG - Intergenic
1139871681 16:70113513-70113535 TCAGCACCCAGAACAGTGCCTGG - Intergenic
1140128468 16:72137241-72137263 CCAGCACCCAGGACAGTGCCGGG - Intronic
1140129897 16:72151228-72151250 CCTGCACACAGGACTATGTCAGG + Intronic
1140364254 16:74368970-74368992 TCAGCACCCAGAACAGTGCCTGG + Intergenic
1140551394 16:75870047-75870069 CCAGCAACCAGGAGAGTGCCTGG - Intergenic
1140895694 16:79322543-79322565 CCAGCACCCAGCACAATGTCTGG - Intergenic
1141070767 16:80952613-80952635 CCTGGACTCAGGACACTTCTGGG + Intergenic
1141088001 16:81110498-81110520 CCTGCAGCCCAGACACTGCATGG + Intergenic
1141097404 16:81172637-81172659 CCTCAACCCAAGACACAGCCGGG - Intergenic
1141191915 16:81831281-81831303 CCAGCTCCCAGAACAGTGCCTGG + Intronic
1141610543 16:85178733-85178755 ACTGCCCCCAAGACCCTGCCTGG - Intronic
1141678624 16:85530996-85531018 CCTGCTCCCAGCACAGAGCCAGG - Intergenic
1142226640 16:88880859-88880881 CCTGCACTCAGGGCCCAGCCAGG - Intronic
1142226664 16:88880939-88880961 CAGGCACCCAGGGCAGTGCCCGG + Intronic
1142256395 16:89015733-89015755 CCTGCACCCTGCACCCTGCCCGG + Intergenic
1203108206 16_KI270728v1_random:1429287-1429309 CTGGCACCCAGCACAGTGCCAGG - Intergenic
1143162046 17:4878306-4878328 CCTGCCCCTAGGACCCTGCTGGG + Exonic
1143472886 17:7186929-7186951 CCAGCATCTAGAACACTGCCTGG + Intergenic
1143498626 17:7326405-7326427 CCTGCACCCCCGCCCCTGCCCGG + Intronic
1143567446 17:7732824-7732846 CCAGAACCTAGTACACTGCCTGG - Intronic
1143883332 17:10047215-10047237 CCTGCAGCCAGGGCATTGGCTGG - Intronic
1144021941 17:11245458-11245480 GCTGCACCCAGGAAACCGCCTGG + Intronic
1144035505 17:11361770-11361792 CCTGCAGCGAGCACAGTGCCTGG - Intronic
1144333732 17:14249737-14249759 CCAGGACCCAGCACAGTGCCTGG + Intergenic
1144573074 17:16412548-16412570 CCAGCAACCAGCACAGTGCCTGG - Intergenic
1144619974 17:16812306-16812328 TCAGCACCCTGGACAGTGCCTGG + Intergenic
1144892713 17:18503398-18503420 TCAGCACCCTGGACAGTGCCTGG - Intergenic
1145076878 17:19862877-19862899 CCAGCACTCAGAACAATGCCTGG + Intronic
1145139500 17:20440889-20440911 TCAGCACCCCGGACAGTGCCTGG + Intergenic
1145310306 17:21697654-21697676 CCTACACCCAGGGCAGGGCCTGG + Intronic
1145388978 17:22440523-22440545 CCTGCTCCCAGGACAGGGCTGGG - Intergenic
1145785832 17:27593339-27593361 CCTGCACCCAGCAGCCAGCCAGG - Intronic
1145796393 17:27657841-27657863 TCAGCACCCTGGACAGTGCCTGG - Intergenic
1145825540 17:27874643-27874665 CCAGCACCCAGCACAGTGTCTGG - Intronic
1145878645 17:28338499-28338521 CCTGCACCAAGAACACTGGCCGG + Intronic
1146037080 17:29416927-29416949 CCAGCATCAAGGACAGTGCCAGG + Intronic
1146523851 17:33549116-33549138 CCAGCACCTAGAACAGTGCCCGG + Intronic
1146673056 17:34755226-34755248 CCAGAACCCAGAACAATGCCTGG - Intergenic
1147309156 17:39584072-39584094 CCTGCACCTAGGACAAGACCAGG - Intergenic
1147569269 17:41557795-41557817 CAAGCACCTAGGACAGTGCCTGG + Intergenic
1147951070 17:44108372-44108394 CCAGCACCTAGCACAGTGCCTGG - Intronic
1148285958 17:46391808-46391830 CCTGCACCTAGCACAGTGCCTGG + Intergenic
1148308122 17:46609429-46609451 CCTGCACCTAGCACAGTGCCTGG + Intronic
1148342275 17:46880439-46880461 CAAGCACCCAGGATGCTGCCTGG - Intronic
1148477681 17:47940141-47940163 CAGGCACCCAGGACTGTGCCAGG - Intergenic
1148737124 17:49871166-49871188 CTGGCACCCAGGGCACTGCCTGG - Intergenic
1148866610 17:50632062-50632084 TCAGCACCCAGGACAGTGCCTGG - Intergenic
1149463565 17:56855008-56855030 CCAGCACCTACGACAGTGCCTGG - Intronic
1149577101 17:57722009-57722031 CCTACACCTAGGACAGTGTCTGG - Intergenic
1150623420 17:66824834-66824856 CCTGCTCCCAGGACGGAGCCTGG + Intergenic
1150630560 17:66877491-66877513 CCTGCACTCAGGCCTCTGGCGGG + Exonic
1151284990 17:73104425-73104447 CATTCACCCAGGACACATCCAGG - Intergenic
1151687970 17:75660761-75660783 CCTGCTCCCAGGTGACTGCACGG - Intronic
1152224874 17:79088058-79088080 CCTCCACCCAGGACAGTCCCCGG - Intronic
1152224885 17:79088102-79088124 CGTCCACCCAGGACAGTCCCCGG - Intronic
1152320801 17:79608128-79608150 CCAGCACCAAGGACAGGGCCGGG - Intergenic
1152760889 17:82106484-82106506 CCAGCTCTCAGGCCACTGCCTGG - Intronic
1152998379 18:429995-430017 CCAGCTCCCAGGACAGGGCCTGG + Intronic
1153740778 18:8125066-8125088 CCAGCACCTAGGACTGTGCCAGG + Intronic
1153823751 18:8855904-8855926 CCTGCACCCAGCCCAGTGTCTGG - Intergenic
1153975328 18:10263820-10263842 GCTGCTCCCAGGAGGCTGCCAGG + Intergenic
1154106369 18:11527273-11527295 CCTTCAACCAGGACACTCCTGGG - Intergenic
1155188441 18:23408330-23408352 CCAGCACCAAGAACAATGCCTGG + Intronic
1155208242 18:23578923-23578945 TCTGCACCAGAGACACTGCCGGG - Intronic
1155673537 18:28401800-28401822 CCAGCACCCAGAACAATGCCTGG - Intergenic
1155832509 18:30535497-30535519 CCAGCACTCAGAACAGTGCCTGG - Intergenic
1156355902 18:36339643-36339665 CCTGCACCCAGGCCCCTGCTGGG - Intronic
1157086770 18:44588484-44588506 TCAGCACCTAGCACACTGCCAGG - Intergenic
1157110227 18:44813749-44813771 GCAGCACTCAGGACACTGCTTGG - Intronic
1157246449 18:46058872-46058894 CTAGGACCCTGGACACTGCCTGG + Intronic
1157469386 18:47976950-47976972 CCAGCACCGAGAACAGTGCCTGG + Intergenic
1157521715 18:48349895-48349917 CCTGCACCTAGCACAGTGCCTGG + Intronic
1158277949 18:55789358-55789380 CCTGCATCCAGGACAAGGACTGG - Intergenic
1158333097 18:56384430-56384452 CCAGCACCCAGCACAGAGCCTGG + Intergenic
1159125633 18:64220775-64220797 TTAGCACCCAGCACACTGCCTGG - Intergenic
1159647456 18:70936111-70936133 CCGGCCCCCAGGTCACTGACAGG + Intergenic
1160019962 18:75172729-75172751 CCTGCACCCAGCACCATGCCTGG + Intergenic
1160585518 18:79911489-79911511 CCTGTCCCCAGGTCACCGCCCGG + Intronic
1160768784 19:821367-821389 CCCGCCCCGAGGCCACTGCCGGG + Intronic
1161723645 19:5916640-5916662 CCTGCCCCCAGGACAGTCCAGGG - Exonic
1161748153 19:6074411-6074433 CCTGTACCCAGGGCACTGTGTGG - Intronic
1162088469 19:8262351-8262373 CCAGCCCCCAGGCCACAGCCTGG - Exonic
1162318190 19:9953975-9953997 CCAGCACCCAGGCGGCTGCCCGG - Intergenic
1162458149 19:10798240-10798262 CCTGCCCCCCGGTCACTGGCTGG + Intronic
1162580705 19:11528624-11528646 CCAGCACCAAGGACAGTGCCTGG + Intronic
1163447249 19:17353852-17353874 CCAGCACCCAGCACCATGCCCGG + Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1163952932 19:20607534-20607556 CCTTCACCCACCACCCTGCCTGG + Intronic
1164589103 19:29496360-29496382 GCTGCAGCCAGGACAGTGCTGGG + Intergenic
1164703658 19:30303877-30303899 CCAGCATCCACGACTCTGCCTGG + Intronic
1164725915 19:30465528-30465550 CCAGCACCCACGGCAGTGCCTGG + Intronic
1164840146 19:31387140-31387162 CCAGCTCCCAGGGCACTGGCAGG - Intergenic
1165034049 19:33020120-33020142 CTGGCACCCAGCACAGTGCCAGG + Intronic
1165387775 19:35521506-35521528 CCAGCACCCAGGCTAGTGCCTGG + Intergenic
1165832398 19:38736189-38736211 CCTGCGTCCAGGCCACTACCTGG - Exonic
1166007422 19:39917031-39917053 CCAGCACCAAGGACAGGGCCTGG + Intronic
1166386085 19:42382103-42382125 CAAGCACCCAGCACAGTGCCTGG - Intergenic
1166529859 19:43535563-43535585 CCGGCAGCCAGGCGACTGCCTGG + Exonic
1166549008 19:43652581-43652603 CCAGCACCCAGCACGGTGCCTGG - Intronic
1166562524 19:43742621-43742643 CCAGCACCTAGAACAGTGCCTGG + Intronic
1166653957 19:44596577-44596599 CCAGCACCCAGCACAGTGCCTGG - Intergenic
1166710600 19:44934759-44934781 CCTACAAACAGGACACTACCCGG + Intergenic
1166891022 19:45993178-45993200 CCAGCACCCAGAAAAGTGCCTGG + Intergenic
1166925632 19:46265148-46265170 CCTGCCCCCTTCACACTGCCTGG - Intergenic
1166959578 19:46489506-46489528 CCTGCACCAAGAACAGGGCCTGG + Intronic
1167094536 19:47367287-47367309 CCAGCACCTAGAACAGTGCCTGG - Intronic
1167325157 19:48819844-48819866 CCAGCACCTATAACACTGCCAGG + Intronic
1167582804 19:50356417-50356439 CCAGCACCTAGGACAGAGCCTGG + Intronic
1167607129 19:50487480-50487502 CCGGAACTCTGGACACTGCCTGG - Exonic
1167704948 19:51076364-51076386 CCAGCACCCAGAACAATGCCTGG + Intergenic
1167850951 19:52201492-52201514 CCTGCACCCATGTCACTAGCTGG - Intronic
1168140285 19:54381425-54381447 CCTGCACCTAGGACAGTCCCTGG + Intergenic
1168302824 19:55416346-55416368 CAAGCACCCAGAACAGTGCCCGG - Intergenic
1168331051 19:55568970-55568992 GCTGCACCTTGGACAGTGCCTGG + Intergenic
1168354068 19:55691427-55691449 CCTGCTCCCAGGTCCTTGCCCGG - Intronic
925263217 2:2546092-2546114 CCCCAACCCAGGACAATGCCAGG - Intergenic
926113383 2:10196526-10196548 CCAGCAACCAGGACACAGCCTGG - Intronic
926206829 2:10840007-10840029 CCAGCACCAAGGACAGTGCCCGG - Intergenic
926464829 2:13175441-13175463 CCTGCACCCAGGGCCTTGTCTGG + Intergenic
927505247 2:23609148-23609170 CCAGCATCTAGCACACTGCCTGG - Intronic
928375753 2:30771955-30771977 TCAGCACCTAGGACAATGCCTGG + Intronic
928749736 2:34457768-34457790 CCTAAACCCAGCACATTGCCAGG - Intergenic
929464008 2:42128594-42128616 CCTGCACCTAGAACAGTGCCAGG + Intergenic
929624317 2:43390785-43390807 CAAGCACCCAGAACAGTGCCTGG + Intronic
929870928 2:45758750-45758772 CCTGAGCCTAGGACACTGCCTGG + Intronic
929962816 2:46509170-46509192 CCAGCACCCAGCACAGTGCCTGG + Intronic
930048524 2:47194905-47194927 CCTGTGCCCAGGCCCCTGCCAGG + Intergenic
930354568 2:50301246-50301268 AAAGCACTCAGGACACTGCCTGG - Intronic
930502542 2:52240109-52240131 CCAGTACCCAGGATAGTGCCTGG - Intergenic
930614561 2:53579795-53579817 CCAGCACCTAGTACCCTGCCTGG - Intronic
930659170 2:54036802-54036824 CCTACACCCAGGACATTGGCGGG + Intronic
931265867 2:60660049-60660071 CCTGCACCTAGCACAGTGCCTGG - Intergenic
932120231 2:69091997-69092019 CCAGCACCTAGCACAGTGCCTGG - Intronic
932344102 2:70984664-70984686 GCTGCACCCAGGCCACTCTCTGG + Exonic
932457087 2:71856864-71856886 CCAGCACCAAGGACAGCGCCTGG - Intergenic
932585866 2:73028405-73028427 CCTGCGCCCAGGCCTCTGACAGG - Intronic
933213260 2:79596196-79596218 CCAACACTCAGGACGCTGCCTGG + Intronic
933998419 2:87686645-87686667 CCTGCAGCCAGCAGAGTGCCTGG - Intergenic
934515890 2:94986204-94986226 CAGGCACCCAGGACCATGCCTGG + Intergenic
934862624 2:97777055-97777077 CCAGCACACAGAACACTGCTGGG - Intronic
935012846 2:99152103-99152125 CCAGCACCAAGCACAGTGCCAGG - Intronic
935185226 2:100725576-100725598 CCTGTTCACAGGACAGTGCCAGG + Intergenic
935694276 2:105757585-105757607 ACGGCACCCAGCACAGTGCCTGG - Intronic
936145148 2:109975866-109975888 CCTGTCCCCATGACACTGCTGGG - Intergenic
936199537 2:110395612-110395634 CCTGTCCCCATGACACTGCTGGG + Intergenic
936295430 2:111264228-111264250 CCTGCAGCCAGCAGAGTGCCTGG + Intergenic
936377507 2:111954491-111954513 CCATCACCCAGCACAGTGCCTGG + Intronic
936896695 2:117435676-117435698 CCAGCACCCACCACAGTGCCTGG - Intergenic
937173565 2:119903053-119903075 ACTGCACCCAGGATACAGCTAGG + Intronic
937222620 2:120350525-120350547 CCTGCTCCCAGGTCTCTGACGGG - Exonic
937344809 2:121119012-121119034 CCTGTATCCATGAAACTGCCTGG - Intergenic
937596173 2:123676872-123676894 CCAGCAACCATGACACTGCCTGG + Intergenic
937883212 2:126883593-126883615 CCAGCATCCAGGACAGGGCCGGG - Intergenic
937911569 2:127078110-127078132 CCTGGTACCAGGACACAGCCAGG + Intronic
938108232 2:128547538-128547560 CCAGCACCTAGTACAGTGCCTGG - Intergenic
938558267 2:132446474-132446496 CCAGCACCTAGCACAATGCCTGG - Intronic
938694061 2:133819492-133819514 TCTGCTCCCAAGATACTGCCCGG - Intergenic
938772531 2:134512625-134512647 CTTGCCCCCAGAACAGTGCCTGG - Intronic
938923617 2:136018465-136018487 CCTTCACCCAGGCCACTACAGGG + Intergenic
938953613 2:136279197-136279219 CCAGCACCGAGAACAGTGCCTGG + Intergenic
939096063 2:137834917-137834939 GAAGCACCCAGGACACTGCCTGG - Intergenic
939498089 2:142948125-142948147 GCTGCACCCTGGTCACTGCCTGG + Intronic
940994342 2:160131537-160131559 CCTGCACTAAGCACAATGCCAGG + Intronic
941563168 2:167075133-167075155 CTAGCACCTAGAACACTGCCTGG + Intronic
941921895 2:170859383-170859405 CCAGAGCCCAGGATACTGCCTGG - Intronic
942312218 2:174666600-174666622 TCTGCACCCAGCTCAGTGCCTGG + Intronic
944103872 2:196058426-196058448 TCCGCACCCAGGACTCTCCCAGG + Intronic
944579524 2:201119242-201119264 TCGGCACCCAGAACTCTGCCTGG - Intronic
944633967 2:201656572-201656594 CCAGCACCCAAGACAATGCCTGG - Intronic
945185620 2:207136698-207136720 CCAGCACCCAGCACAGTACCTGG + Intronic
947840064 2:233202109-233202131 CTTGCACCCAGGGCTCTTCCTGG + Intronic
947907024 2:233772325-233772347 ACTCCACCCAGAACACGGCCAGG - Exonic
947946757 2:234110404-234110426 TCAGCACCTAGGACAGTGCCTGG - Intergenic
948107468 2:235427201-235427223 CATGCACCCTGGAGACTGGCTGG - Intergenic
948262773 2:236616361-236616383 CCTGTACCTAGCACAGTGCCTGG - Intergenic
948279184 2:236733388-236733410 CCTGAATCAAGGACAATGCCAGG + Intergenic
948409738 2:237749854-237749876 TCAGCACCCAGGACAGTGCCAGG + Intronic
948461205 2:238130794-238130816 CCTGAAGCCAGGCCACTGCGGGG - Exonic
948906499 2:240982119-240982141 GCTGCCCCCAGGACACTGCCCGG - Intronic
1168847524 20:955536-955558 CCAGCACCCAGGACAGTACCAGG + Intergenic
1168849343 20:965866-965888 CCAGCACCTAGGAAAGTGCCTGG + Intronic
1169225606 20:3854762-3854784 CCTGCCCCCAGGCCAGTGTCGGG - Intronic
1169880607 20:10342305-10342327 CCAGCACCCATGCCAATGCCTGG + Intergenic
1170775706 20:19373097-19373119 CCTGGACAGAGGACATTGCCAGG - Intronic
1170779392 20:19410668-19410690 CCAGCACCAAGAACATTGCCTGG + Intronic
1170882744 20:20311539-20311561 CCTCCACTCAGGACTCTGCATGG - Intronic
1171265268 20:23766605-23766627 TCTGCAGCCAGGATACTTCCAGG - Intergenic
1171282440 20:23912112-23912134 TCTGCAGCCAGGACGCTCCCAGG - Intergenic
1171795433 20:29562342-29562364 TCAGCACCCAGCACAGTGCCTGG + Intergenic
1171820736 20:29835805-29835827 CCTGCTCACAGGACACAGCTTGG - Intergenic
1171853017 20:30321921-30321943 TCAGCACCCAGCACAGTGCCTGG - Intergenic
1172098102 20:32470431-32470453 CCAGCACCCAGCACAGGGCCTGG - Intronic
1172122856 20:32608814-32608836 CCAGCACCGAGGACAGTGCCAGG + Exonic
1172445031 20:34988609-34988631 CCTGCACCCAGGGCAGTTCTAGG - Intronic
1172842327 20:37909423-37909445 CTGGGACCCAGGACAATGCCCGG + Intronic
1173173771 20:40748467-40748489 CCAGCACCCTGGAGCCTGCCTGG + Intergenic
1173288606 20:41694650-41694672 CCAGCACTCAACACACTGCCTGG - Intergenic
1173390110 20:42624087-42624109 CCAGCACCTAGGACAGTGCCTGG - Intronic
1173404764 20:42754917-42754939 CCTGCACTCAGCGCAGTGCCTGG - Intronic
1173747409 20:45448478-45448500 CCAGCACTTAGGACAGTGCCTGG + Intergenic
1173755834 20:45515340-45515362 TCAGCACCTAGGACAGTGCCTGG + Intronic
1173899497 20:46576759-46576781 CCATCTCCCAGGACACTTCCTGG + Intronic
1174037150 20:47675325-47675347 CCTGCGCCTAGGACAGTGCCTGG + Intronic
1174062828 20:47844630-47844652 CCTGCACCTAGCACAGTGCCTGG + Intergenic
1174082739 20:47982773-47982795 CCAGCACCCAGAGCAGTGCCTGG - Intergenic
1174151181 20:48487626-48487648 CCTGCACCTAGCACAGTGCCTGG + Intergenic
1174202927 20:48819796-48819818 CCAGCACCTAGCACAGTGCCTGG + Intronic
1174280409 20:49434982-49435004 CCTTCACCTAGTACAGTGCCTGG + Intronic
1174363328 20:50041798-50041820 CCAGCACCCAGAACGGTGCCTGG - Intergenic
1174572561 20:51512457-51512479 CCTGCAACCAGCACAGTGCCTGG + Intronic
1174588148 20:51624608-51624630 CATGCACGCTGGACACTGCTCGG + Intronic
1174805978 20:53604815-53604837 CCAGCACCTAGAACAATGCCTGG - Intronic
1174981001 20:55394698-55394720 TCTGCATCCAGCACAGTGCCTGG - Intergenic
1175143415 20:56877854-56877876 CCAGGACCCAGCACAGTGCCTGG - Intergenic
1175344236 20:58260272-58260294 TCAGCACCCAGCACAGTGCCAGG - Intergenic
1175538506 20:59732821-59732843 CCGGCACCTAGCACAGTGCCTGG - Intronic
1175546831 20:59783704-59783726 ACAGCACCCAGGGCAGTGCCTGG - Intronic
1176025048 20:62981544-62981566 CCTGCACCACGGACAGAGCCTGG - Intergenic
1176027397 20:62993143-62993165 CCTGCCCCCAGGAAACTCACTGG + Intergenic
1176238979 20:64067240-64067262 CCTGCCCCCAGCACACACCCTGG - Intronic
1176427739 21:6559135-6559157 CACACACCCAGGACACTCCCGGG - Intergenic
1176675110 21:9770513-9770535 CCTGCTCCCAGGCCACCCCCAGG - Intergenic
1176732830 21:10517903-10517925 CCAGCACCTAGAACAATGCCTGG + Intergenic
1176952964 21:15066633-15066655 TCAGCACCCAGCACAGTGCCGGG + Intergenic
1179141434 21:38728853-38728875 CCAGCACCTAGGACAGTGCCTGG + Intergenic
1179395200 21:41033438-41033460 CCAGCACCCAGTACAATGTCTGG + Intergenic
1179703231 21:43167452-43167474 CACACACCCAGGACACTCCCGGG - Intergenic
1179722374 21:43323002-43323024 CCAGCACCTTGGACAGTGCCTGG + Intergenic
1179886204 21:44315237-44315259 CTTGCATCCAGGCCACTTCCAGG - Intronic
1179967863 21:44817510-44817532 CCCGCACCCAGGGCGATGCCGGG + Intronic
1180179132 21:46110140-46110162 CCTTCACCCAGCACACCACCCGG + Intronic
1180488324 22:15820564-15820586 GCTGCAGCCAGGAGACTCCCGGG + Intergenic
1180681990 22:17634607-17634629 CTAGCACCCAGCACCCTGCCTGG + Intronic
1180879893 22:19196203-19196225 CCTGCACCCAGAATAGGGCCTGG + Intronic
1181018793 22:20087412-20087434 CCTCCACCCAGCCCACTACCTGG - Intronic
1181079880 22:20406828-20406850 CCTGCACCCAGCAGGCTGCCAGG - Exonic
1181458712 22:23073782-23073804 CCTGCACCTGGCACAGTGCCTGG - Intronic
1181908393 22:26217986-26218008 CCAGCACCCAGGAGATTGACAGG - Intronic
1181980553 22:26762978-26763000 CCAGCACCCAGTACAGAGCCTGG - Intergenic
1183009862 22:34936045-34936067 CCAGCACCTAGAACAATGCCTGG - Intergenic
1183075125 22:35422099-35422121 CCAGCACCTAGAACAGTGCCTGG - Intronic
1183257931 22:36775063-36775085 CAAGCACCCAGAACAATGCCTGG - Intronic
1183271359 22:36864554-36864576 CCTGCACCCACAGCACAGCCAGG + Intronic
1183323827 22:37180791-37180813 CCTCCTCCCAGGGCTCTGCCAGG - Exonic
1183453867 22:37911014-37911036 GATGCACCCAGGAGGCTGCCCGG + Intronic
1183501942 22:38185567-38185589 CGTGCACCAAGAACACTGCCTGG - Intronic
1183675440 22:39296714-39296736 CCAGCACCTAGGGCAGTGCCTGG + Intergenic
1183731712 22:39622151-39622173 TCAGCACCCAGAACTCTGCCTGG + Intronic
1183817164 22:40312223-40312245 CCTGCTCCCAGGAGACTTCAGGG - Intronic
1184262144 22:43324465-43324487 CCTCCATCCAGGACACTGGGAGG - Intronic
1184343849 22:43900988-43901010 CCAGCACCCTGGCCAATGCCAGG - Intergenic
1184349870 22:43936477-43936499 CCAGCACCCAGGACAGGGCCTGG + Intronic
1184388972 22:44192293-44192315 CCTCCAACCAGGTCCCTGCCTGG + Intronic
1184621350 22:45680954-45680976 CCTGCACTCAGTACAATGCTTGG + Intronic
1184629274 22:45763189-45763211 CCTGCCCCCAGAACACTGCCCGG - Intronic
1184642788 22:45881060-45881082 CCTGCCCCCAGGACCCCGGCTGG - Intergenic
1184679278 22:46061681-46061703 ACCGCACCCTGGACTCTGCCTGG + Intronic
1184956134 22:47887542-47887564 TCTGCACCCCTGACACTTCCAGG - Intergenic
1184968320 22:47997254-47997276 CCCACACCCAGGACACTCACAGG + Intergenic
1185074039 22:48673619-48673641 CCTACACACAGTACACAGCCAGG - Intronic
949509291 3:4754285-4754307 ACAGCACCCAAGTCACTGCCAGG + Intronic
949864830 3:8538824-8538846 CCTGCACCCAGGACGGTGCAGGG + Intronic
949922122 3:9011080-9011102 CCTCCTACCAGCACACTGCCTGG - Intronic
949940708 3:9152127-9152149 CCTGTACCTAGAACATTGCCTGG + Intronic
950130965 3:10546464-10546486 CCTGTTCCCAGGACTTTGCCTGG + Intronic
950516668 3:13470931-13470953 CATGTACCCAGCACAGTGCCTGG - Intergenic
951553481 3:23897886-23897908 CCTGTACCTAGAACAATGCCTGG + Intronic
951672735 3:25203346-25203368 CCTGAATACAGGACACTGACAGG + Intronic
952225706 3:31373553-31373575 CCTGCATCTAGAACAGTGCCTGG + Intergenic
952495904 3:33915595-33915617 CCAGCAGCATGGACACTGCCTGG + Intergenic
952698457 3:36298384-36298406 TCAGTACCCAGGACAGTGCCTGG + Intergenic
952909797 3:38173768-38173790 CCAGCATCCAGAACAGTGCCTGG - Intronic
952968596 3:38636746-38636768 CCTGCAGGCAGGACTCAGCCAGG - Intronic
953318142 3:41947602-41947624 AATGCACCCAGCACACTGGCTGG + Intronic
953338715 3:42116092-42116114 CCAGCACCCGGAACCCTGCCTGG - Intronic
953449399 3:42993768-42993790 CCAACACCCAGCACAGTGCCTGG - Intronic
953470035 3:43158641-43158663 CCAGCACCCAGAACACTACCTGG - Intergenic
953646180 3:44757547-44757569 CCAGCACCTAGCACAGTGCCTGG - Intronic
953884620 3:46708312-46708334 TCTGCCCCCAGGAGTCTGCCAGG + Intronic
953913830 3:46905773-46905795 TCTGCACCCAGGGCAGTGCCAGG + Intergenic
954049667 3:47963678-47963700 CCAGCACCTAGAACACTGTCTGG - Intronic
954375773 3:50193495-50193517 CCTGCCCCCAGGACGACGCCCGG + Exonic
954574453 3:51668025-51668047 ACTGGACCCAGGACCCTCCCTGG + Exonic
954699363 3:52443351-52443373 TCTGCACCCAGGCCATTGCCAGG - Intronic
954793105 3:53147398-53147420 ACTGCGCCCAGGACAGTGCGAGG + Intergenic
954795453 3:53159422-53159444 CCAGCACCCAGCACACAGCCTGG + Intronic
955016723 3:55077428-55077450 CCAGCTCCCAGAACAGTGCCTGG + Intergenic
955026334 3:55171272-55171294 CCAGCATCCAGGACAGTGCAGGG + Intergenic
955041457 3:55321393-55321415 CCGGCATCCAGCACATTGCCTGG + Intergenic
955481298 3:59393255-59393277 CCTGTACCTAGTACAGTGCCTGG - Intergenic
955522538 3:59788670-59788692 CCTGCACCCAGCCCAGGGCCTGG + Intronic
955727468 3:61948420-61948442 CCAGCACCTAGAACAATGCCTGG - Intronic
956183760 3:66543620-66543642 CCAGCACCCAGAACAATGCCTGG + Intergenic
956606673 3:71079755-71079777 TCAGCACCCAGCACAGTGCCTGG + Intronic
956977516 3:74598815-74598837 CCTGTGCCCAGCACACTACCTGG - Intergenic
957064704 3:75512008-75512030 CCACCACCCAGCACAGTGCCTGG + Intergenic
957181913 3:76889621-76889643 CCAGAACCTAGAACACTGCCTGG - Intronic
959123530 3:102262771-102262793 CCTGCACCCACCACCATGCCTGG + Intronic
960341365 3:116479008-116479030 CTTGCACCCAGGCCACAGGCTGG - Intronic
961288649 3:125827385-125827407 CCACCACCCAGCACAGTGCCTGG - Intergenic
961432169 3:126891046-126891068 CCAGCACACAGGGCAGTGCCTGG - Intronic
961559937 3:127721756-127721778 CCTGCCCCATGGTCACTGCCTGG - Intronic
961657727 3:128452607-128452629 GGAGCACTCAGGACACTGCCTGG + Intergenic
961721707 3:128901377-128901399 ACTGCACTCATGACACTACCTGG - Intronic
961861747 3:129922096-129922118 CATGCACCCACCACAATGCCCGG + Intergenic
961898414 3:130188645-130188667 CCACCACCCAGCACAGTGCCTGG + Intergenic
962083820 3:132169517-132169539 CCAGCACCTGGAACACTGCCTGG - Intronic
962493685 3:135918708-135918730 CCAGCACCTAGAACACTGCCTGG + Intergenic
962675971 3:137758967-137758989 CCAGCACCTAGCACAATGCCTGG + Intergenic
962843597 3:139256175-139256197 CCAGCACCCAGGCCAGTGCTTGG - Intronic
963741437 3:149085987-149086009 CCTCCACCGAGCACAATGCCTGG + Intronic
963867036 3:150372777-150372799 CCAGCACTCAGCACACTGCCAGG - Intergenic
964129954 3:153275934-153275956 CCTTCCCCCAAGACACAGCCAGG - Intergenic
964191823 3:154011835-154011857 CCAGCACCCAGCACAGAGCCTGG - Intergenic
964406068 3:156350867-156350889 CCTGCACCTAGCCCAGTGCCAGG - Intronic
964620631 3:158717249-158717271 CCTGCACCCAGCACAGTACTTGG - Intronic
965984544 3:174736006-174736028 CCAGCACCCAGGCCAGTGCCTGG - Intronic
966095134 3:176190880-176190902 TCTGCTCCCAGGACAGTTCCTGG - Intergenic
966433080 3:179853223-179853245 CTAGCACCCAGCACAGTGCCTGG + Intronic
967144151 3:186591981-186592003 CCAGCACCTAGCACAGTGCCTGG - Intronic
967323733 3:188218680-188218702 CCAGCACCTAGCACAATGCCTGG - Intronic
967526096 3:190494634-190494656 CCAGCACCCAGAACATTACCTGG + Intergenic
967557561 3:190876780-190876802 CCAGCACCTAGAACAGTGCCTGG - Intronic
968790961 4:2661524-2661546 ACTGCACCTGGGACGCTGCCTGG - Intronic
968851000 4:3078266-3078288 CCTGCACCTATAACAGTGCCAGG - Intronic
969116663 4:4874479-4874501 CTGGCACCCAGGCCCCTGCCAGG - Intergenic
969447357 4:7253010-7253032 CTTGGACCCCTGACACTGCCTGG + Intronic
969563434 4:7963670-7963692 CCTGCACCCAGGACAGTGCCAGG + Intergenic
969804370 4:9595279-9595301 CCAGCACCCAGCACAGTGCCTGG - Intergenic
970683148 4:18534679-18534701 CTTGCAGACAGGACACTGCGTGG + Intergenic
970982381 4:22114996-22115018 TCAACACCCAGGACAGTGCCTGG + Intergenic
971000149 4:22313061-22313083 CCAGCACCAAGAACAGTGCCTGG + Intergenic
972250898 4:37299630-37299652 CCTGCACCCAACACTCTGCTAGG - Intronic
973712869 4:53646502-53646524 CCAGCATCCAGAACAGTGCCTGG + Intronic
973793237 4:54397205-54397227 CCAGCACCTAGAACAGTGCCTGG + Intergenic
974043609 4:56878815-56878837 CCAGCACCTAGCACAGTGCCTGG - Intergenic
976366555 4:84239444-84239466 CCAGCACACAGGACATTGCAAGG - Intergenic
977190899 4:93999868-93999890 CCAGCACTCAGGACATTGCCTGG + Intergenic
977690102 4:99896138-99896160 CCAGCACCCAGCTCACTGCCTGG + Intergenic
980965750 4:139519051-139519073 CCTGCACCTAGAAGAGTGCCCGG - Intronic
981791544 4:148542607-148542629 CCAGCACCTAGAACAGTGCCTGG + Intergenic
982114751 4:152088869-152088891 CCAGCACCTAGCACAGTGCCTGG - Intergenic
982227636 4:153180910-153180932 CCAGCACTCAGGACAATGCCTGG - Intronic
982228839 4:153189710-153189732 CCAGCACCCAGAACAATGTCTGG + Intronic
982383003 4:154770183-154770205 CCTGCCACCAGGACCCTCCCTGG + Intergenic
982862078 4:160464625-160464647 CCAGCACCTAGAGCACTGCCTGG - Intergenic
983459206 4:168006328-168006350 CCTCCACCGAGGTCTCTGCCCGG - Intergenic
985900217 5:2782936-2782958 CCACCAACAAGGACACTGCCAGG - Intergenic
986209399 5:5656434-5656456 CCAGTACCCAGAACAGTGCCTGG + Intergenic
986585526 5:9313026-9313048 CCAGCAGCCAGCACACTTCCTGG - Intronic
986713635 5:10506310-10506332 CCTGCACCTAGAACAATGCCTGG - Intronic
987031624 5:13981352-13981374 CCAGCACCCAGCACCGTGCCTGG + Intergenic
987125088 5:14804424-14804446 CCTGCACCCAGAACAATTCTAGG + Intronic
987326414 5:16815584-16815606 CTGGAACCAAGGACACTGCCAGG - Intronic
987673420 5:21044337-21044359 CCAGCATGCAGGCCACTGCCTGG - Intergenic
988665795 5:33326062-33326084 CCAGCACCTAGAACACTACCAGG + Intergenic
989285806 5:39698724-39698746 CCAGTACCTAGGACAATGCCTGG - Intergenic
989490457 5:42047063-42047085 CCAGCACCCAGTACACTGCCTGG - Intergenic
989541099 5:42619576-42619598 CCAGCAACTAGGACAGTGCCTGG + Intronic
990736346 5:58867448-58867470 CCAGCACCTAGAACAGTGCCTGG + Intergenic
990988302 5:61661207-61661229 CCAGCACCCAGCACAGTGCCTGG - Intronic
993670017 5:90748888-90748910 CCTGCACCCAGAAAAGTGCCTGG + Intronic
995060783 5:107809851-107809873 CCAGCACCTAGGACAATGCCTGG - Intergenic
995378700 5:111508317-111508339 CCACCACCTAGAACACTGCCTGG + Intronic
995545137 5:113222809-113222831 ACTGCACCCAGTGCACTGTCAGG + Intronic
996602301 5:125278485-125278507 CCTGCACCTAGTAAACTGCCTGG - Intergenic
997378879 5:133421116-133421138 CCCACACCCAGGCCCCTGCCAGG - Intronic
997826423 5:137110799-137110821 CCAGCACCTAGCACAGTGCCTGG + Intronic
998006855 5:138662781-138662803 CCAGCACCCAGGACAGCGCCTGG + Intronic
998136588 5:139677288-139677310 CCTGCTGCCTGGGCACTGCCAGG + Intronic
998406240 5:141876289-141876311 CCCGCACCCAGGCCACCGCGGGG + Intronic
998462089 5:142317325-142317347 CCAGCACTGAGGACGCTGCCTGG + Intronic
998885746 5:146692128-146692150 CCAGCACCCAGAACAGTGCCTGG + Intronic
998975134 5:147636866-147636888 GCCGCACCCAGGACACAGCTTGG - Intronic
999290203 5:150419973-150419995 CCTTCACCCAAGCCACAGCCTGG + Intergenic
999439217 5:151588613-151588635 CCTGGGTCCAGGACAGTGCCTGG - Intergenic
999492842 5:152068537-152068559 CCAGCACCCAGCACAGTACCTGG + Intergenic
999916212 5:156264827-156264849 CCAGCACCTAGAACAGTGCCTGG + Intronic
1000018596 5:157300118-157300140 CCAGCACCTAGGACAGTGTCAGG - Intronic
1000278807 5:159764259-159764281 CCAGCACCCAGCCCAGTGCCTGG + Intergenic
1000930885 5:167249870-167249892 CCTGCCCCTAGAAGACTGCCTGG + Intergenic
1001054470 5:168437583-168437605 CCAGCACCCAGAACAGTGCCTGG + Intronic
1001164570 5:169351919-169351941 CTGGCACCCACGACACTGCATGG + Intergenic
1001300490 5:170530132-170530154 CTGGCACCTAGTACACTGCCTGG + Intronic
1001340513 5:170839262-170839284 TCTGCATCCAGGACCATGCCAGG - Intergenic
1001414044 5:171530766-171530788 CCAGCACCCAGCACAGTGCTTGG + Intergenic
1001444761 5:171774674-171774696 TCTGCATCCAAGACACTTCCTGG - Exonic
1001608812 5:172983666-172983688 GCTGCAGCCAGGAGACAGCCAGG + Intergenic
1001670951 5:173473458-173473480 TCAGCACCCAGGACATTTCCTGG + Intergenic
1001776788 5:174334835-174334857 CCAGCACCCAGAACCATGCCTGG + Intergenic
1001960053 5:175874457-175874479 CCAGCACCCAGAACAGTGTCTGG + Intronic
1001989118 5:176101496-176101518 TGTGCACACAGGACACAGCCTGG + Intronic
1002139569 5:177130836-177130858 CCAGCACTCAGCACACTGCCTGG + Intergenic
1002227752 5:177736642-177736664 TGTGCACACAGGACACAGCCTGG - Intronic
1002317095 5:178350341-178350363 CCAGCAGCCAGCACAGTGCCTGG + Intronic
1002421940 5:179153455-179153477 CCTGCAGCCGGGACCCTCCCAGG - Intronic
1002871535 6:1170863-1170885 CCAGCACCTGTGACACTGCCTGG - Intergenic
1003110289 6:3247483-3247505 CCAGCACTCAGGACAGTGCCTGG + Intronic
1003113216 6:3265812-3265834 ACTGCACCCAGCACACTGGTGGG + Intronic
1003173930 6:3740943-3740965 CCAGCAACCAGCACAGTGCCTGG + Intronic
1003259056 6:4500125-4500147 CCTGCACCCAGCACACTGCCTGG + Intergenic
1003548604 6:7082423-7082445 CATGCACTCAGCACAGTGCCTGG - Intergenic
1003570634 6:7254237-7254259 CATGGCCCCAGGACTCTGCCTGG + Intergenic
1003577248 6:7308793-7308815 CCAGCACCAAGAACAGTGCCTGG + Intronic
1004287157 6:14331940-14331962 TCTGCACCTAGAACAATGCCTGG + Intergenic
1004409139 6:15364188-15364210 CCAGGACCCAGGACACTGCTGGG - Intronic
1004700918 6:18078716-18078738 CCAGCACCTAGAACAGTGCCTGG - Intergenic
1005457645 6:26036398-26036420 CCTGCACCTAGAACACTCTCTGG - Intergenic
1006269169 6:32950738-32950760 CCTGCACACAGTGTACTGCCAGG - Exonic
1006383988 6:33718689-33718711 CCTGCAGCCCTGGCACTGCCAGG + Intergenic
1006392884 6:33769258-33769280 CCAGCAATCAGAACACTGCCAGG - Intergenic
1006450791 6:34104671-34104693 CCCGCACCCAGGAAGCAGCCAGG + Intronic
1006513763 6:34534915-34534937 CCTGCACCCACGATGCTGCACGG + Exonic
1006522529 6:34579654-34579676 CCAGCACCTAGGGCACTGCTGGG + Intergenic
1006639133 6:35480006-35480028 CCTGCACCCAGGAGGGTGCTGGG + Intronic
1006923399 6:37640748-37640770 CCTGCCCCAAGGACACTGATGGG - Intronic
1007157957 6:39764276-39764298 CTTGCAACCAGGACAGGGCCTGG - Intergenic
1007371021 6:41427339-41427361 GATGCGCCCAGGACAGTGCCAGG - Intergenic
1007396197 6:41579058-41579080 TCTCCACCCAGGACAAAGCCTGG - Intronic
1007428550 6:41762913-41762935 CCAGCACTCAGCACAGTGCCTGG + Intergenic
1007681298 6:43635539-43635561 CCAGCACCTAGGACAGGGCCTGG + Intronic
1007696858 6:43739691-43739713 CCTGCCCCCGGCACAATGCCTGG - Intergenic
1007719921 6:43878847-43878869 CCTGTGCCCAGCACAGTGCCAGG - Intergenic
1007801398 6:44396875-44396897 CCTGCACTCAGGACCCTTCCAGG - Intronic
1007918717 6:45586638-45586660 CCTCCAGCCTGGACACTGGCAGG + Intronic
1007995866 6:46307164-46307186 CCAGCACCCAGCACAGTGCCTGG - Intronic
1010171202 6:72977888-72977910 TCAGCACCTAGAACACTGCCTGG + Intronic
1010280179 6:74014217-74014239 CCTGTTCCCAGGACTCTCCCTGG + Intergenic
1011283969 6:85704813-85704835 CCTGCTCCTAGAACAGTGCCTGG - Intergenic
1011496700 6:87943710-87943732 CCAGCATCTAGAACACTGCCTGG + Intergenic
1011754473 6:90484647-90484669 CCTACACCCAGCACAATGACAGG + Intergenic
1012414818 6:99001849-99001871 CCTGTACCTAGCACAATGCCTGG - Intergenic
1013290662 6:108716656-108716678 CCAGCCCCCACGACTCTGCCTGG - Intergenic
1013635621 6:112026709-112026731 CCTGTGCCCAGCACGCTGCCAGG - Intergenic
1013639382 6:112058439-112058461 CCAGCACCTAGCACAGTGCCTGG - Intronic
1014281441 6:119446336-119446358 CCTCCACCTAGAACAGTGCCTGG + Intergenic
1015684967 6:135849516-135849538 CCAGCACCTAGAACAGTGCCTGG + Intergenic
1016430674 6:143981990-143982012 CCAGCACCTAGAACAATGCCAGG - Intronic
1017204857 6:151793758-151793780 CCAGCCCCTAGCACACTGCCTGG - Intronic
1017524298 6:155229213-155229235 CCTACACCCAGAACAGAGCCTGG + Intronic
1017570562 6:155740579-155740601 CCTGCTACCAGGACTCAGCCAGG - Intergenic
1018103822 6:160464854-160464876 CCTTCACCCAGGAAACTCCAAGG - Intergenic
1018112109 6:160546070-160546092 CCTTCACCCAGGAAACTCCAAGG - Intronic
1018445290 6:163852771-163852793 CCTCCACCCAGAACACTGAGGGG - Intergenic
1018768193 6:166950657-166950679 CCCAGAGCCAGGACACTGCCTGG - Intronic
1018931068 6:168240740-168240762 CCAGCACCCAGCTCAGTGCCTGG - Intergenic
1019139765 6:169936005-169936027 GCTCCACCCAGGAGAGTGCCCGG + Intergenic
1019217924 6:170455468-170455490 CCTGGGCCCAGGACCCTGCTTGG - Intergenic
1019256579 7:56323-56345 CCTGTACCCAGGAGAGTGTCTGG + Intergenic
1019294376 7:266262-266284 TCTCAACACAGGACACTGCCTGG + Intergenic
1019323619 7:426557-426579 CCTGCACCCAGCACAAGTCCTGG - Intergenic
1019359070 7:595467-595489 CCTGCACCCAGAACAGGGCCTGG + Intronic
1019481391 7:1268496-1268518 CAGGCTCCCAGGACACTGCTTGG - Intergenic
1019486720 7:1292816-1292838 CCTACTCCCAGGACAAAGCCAGG - Intergenic
1019506813 7:1395520-1395542 ACTGCACCCCGGAGACCGCCAGG + Intergenic
1019962233 7:4470449-4470471 TCAGCACCTAGGACAGTGCCTGG + Intergenic
1022069805 7:26901706-26901728 CCAGCACCCATGAAACTGACAGG + Intronic
1022845603 7:34206720-34206742 CCAGAACCCAGCACAGTGCCTGG + Intergenic
1022887594 7:34662455-34662477 CCTGGCCCCAGGACAGTGTCAGG + Intronic
1023137154 7:37064146-37064168 CCTGGGCCCTTGACACTGCCTGG + Intronic
1023188795 7:37557380-37557402 CCTTCACCCAAGCCACTTCCAGG - Intergenic
1023621173 7:42074669-42074691 CGTCCACCCAGGGCCCTGCCAGG + Intronic
1024047866 7:45597276-45597298 CCTCCACCCCTGGCACTGCCAGG - Intronic
1024237654 7:47410069-47410091 CCTTCTCCCAGGACACTTCCTGG - Intronic
1024302318 7:47896643-47896665 CCTCCCCCCAGCACACAGCCAGG + Intronic
1024332825 7:48173359-48173381 CCAGCACCCAGAACAGTGCCTGG + Intronic
1025210550 7:57017686-57017708 CCTTCACTCAGAACACTTCCCGG + Intergenic
1025231569 7:57206281-57206303 CCTGCACCTAGCACAGTGCCTGG - Intergenic
1025247342 7:57327248-57327270 CCAGCACCAAGGACAGGGCCTGG + Intergenic
1026640983 7:72125379-72125401 CCTGCTCCTAGAACAGTGCCTGG - Intronic
1026775119 7:73226478-73226500 CCTGTACCCAGGACCCTGTGTGG + Intergenic
1027015976 7:74779849-74779871 CCTGTACCCAGGACCCTGTGTGG + Intronic
1027072053 7:75166088-75166110 CCTGTACCCAGGACCCTGTGTGG - Intergenic
1027183287 7:75954231-75954253 CCCGCATGCAGGACACTGCTTGG - Intronic
1029136869 7:98379215-98379237 CCAGCACCAAGAACACTGCCTGG + Intronic
1029460366 7:100690885-100690907 CTTGCAGCCAAGACACAGCCAGG - Intergenic
1029543488 7:101198354-101198376 CCTGCCCACAGGACTCTGTCCGG - Exonic
1029596188 7:101538685-101538707 CCTGCACCCAGGGTTCTGGCTGG - Intronic
1029709392 7:102291318-102291340 CCTGCACCCAGGACAACCCCAGG - Intronic
1030082416 7:105789291-105789313 CCAGCACCTAGCACAGTGCCTGG - Intronic
1030333421 7:108297585-108297607 CCAGCACCAAGAACACTGCCTGG - Intronic
1030939008 7:115621482-115621504 TATGCACCCAGGACAGTGCCTGG + Intergenic
1031688845 7:124764681-124764703 CCTGCAGCCGGGTCACGGCCCGG + Exonic
1031864696 7:127025583-127025605 CCTGCACCTAGCACAGGGCCTGG - Intronic
1032092787 7:128919950-128919972 CCTGCATCGAGCACAGTGCCTGG - Intergenic
1032525677 7:132577036-132577058 CCCGGCCCCAGGGCACTGCCCGG - Exonic
1032695166 7:134329548-134329570 CCAGCACCTAGAACAGTGCCTGG + Intergenic
1033649321 7:143328924-143328946 CCAGCACCTAGTACAGTGCCTGG - Intronic
1034489813 7:151387226-151387248 CCTGCACCAAGGAGGCTTCCTGG + Intronic
1034531736 7:151700230-151700252 CCAGCACCCAGAACACAGCCCGG - Intronic
1034657665 7:152742154-152742176 CCTGCACCCAGCACAGAGCCTGG - Intergenic
1034692223 7:153023057-153023079 CCTGCTCCCGGGGCACTGCCTGG + Intergenic
1035034906 7:155888418-155888440 CCGACACACTGGACACTGCCAGG - Intergenic
1035056321 7:156039060-156039082 CCTGACCCTAGGGCACTGCCAGG - Intergenic
1035310240 7:157963166-157963188 CCTGAGGCCAGGAGACTGCCCGG - Intronic
1035705356 8:1670536-1670558 CCTGCACCCAGCACTGTGCCTGG + Intronic
1036759518 8:11497573-11497595 CCAGCACCCAGCGCAGTGCCTGG + Intronic
1037271631 8:17136673-17136695 CCTGCACCCAGGCCGCTGTTGGG - Intergenic
1037674343 8:21041205-21041227 CCTTCAGCCTGGAGACTGCCTGG + Intergenic
1037877680 8:22556209-22556231 ACTGTACCCAGCACAGTGCCTGG - Intronic
1037879131 8:22564658-22564680 CCAGCACTCAGGACAGTGGCTGG + Intronic
1038033243 8:23663114-23663136 CCAGCACCCAGGGCCTTGCCTGG + Intergenic
1038250749 8:25901969-25901991 CCAGCACCTAGGATAGTGCCTGG + Intronic
1038490989 8:27971074-27971096 CCATCTCCCAGGCCACTGCCTGG + Intronic
1038498661 8:28025134-28025156 TCAGCACCCAGAACACTGCCTGG + Intronic
1039546452 8:38414354-38414376 CCTCTACCCAGGGCAGTGCCAGG + Intronic
1039773633 8:40714577-40714599 ACTGTCCCCAGGACAGTGCCTGG - Intronic
1039949946 8:42162544-42162566 CCAGTACCCAGCACAGTGCCTGG - Intronic
1040016982 8:42707879-42707901 CCAGCACCTAGAACAGTGCCTGG - Intronic
1040065508 8:43141005-43141027 CCTGCACCCAGTCCACTGTTCGG + Intronic
1040301757 8:46191642-46191664 AGTGCACCCAGGACAGTCCCCGG - Intergenic
1040860142 8:51990549-51990571 CCTGCTCCCAGGTGCCTGCCTGG - Intergenic
1041366734 8:57114279-57114301 CCTCCACCCAGGAGACTGCTGGG - Intergenic
1041451428 8:58010552-58010574 CCAGCACCTAGCACAGTGCCAGG - Intronic
1041522139 8:58768477-58768499 CCTGGGCCCAGCACAGTGCCTGG - Intergenic
1042673302 8:71287773-71287795 CCAGCACCAAGCACAGTGCCTGG + Intronic
1042849077 8:73197930-73197952 CCAGCACCTAGAACAATGCCTGG + Intergenic
1043022714 8:75024465-75024487 CAGGCACCCAGGACCATGCCCGG + Intronic
1043731329 8:83687069-83687091 CCACCACCCAAGACACAGCCAGG + Intergenic
1044488388 8:92781687-92781709 CCTGCACCCAGCACATTGCCTGG - Intergenic
1044747172 8:95382153-95382175 GGTGCACCCAGGCCTCTGCCAGG - Intergenic
1044748286 8:95392544-95392566 CCAGCACCCAGCAGACTGTCAGG + Intergenic
1045099459 8:98829744-98829766 CCAGCACCTAGAACAGTGCCTGG - Intronic
1045494538 8:102697414-102697436 GAAGCACCCAGCACACTGCCTGG + Intergenic
1045871404 8:106931700-106931722 CCAGTACCTAGAACACTGCCTGG - Intergenic
1046750117 8:117918270-117918292 GCTGCACCCAACACAGTGCCAGG + Intronic
1046782554 8:118231139-118231161 AATGCACCCAGGACAATGCCTGG + Intronic
1046985181 8:120380155-120380177 CATACACCCAGCACAGTGCCTGG - Intergenic
1047448264 8:124938965-124938987 CCTGGAGCCAGGAGGCTGCCGGG + Intergenic
1048035486 8:130673596-130673618 CCTGCAGCCAGGACACCACCGGG - Intergenic
1048186137 8:132242669-132242691 CCAGTACCTAGGACAATGCCAGG + Intronic
1048203444 8:132396148-132396170 GGAGCACCCAGGCCACTGCCTGG - Intronic
1048285048 8:133135033-133135055 CCAGCACCCAGCACAGGGCCTGG - Intergenic
1048363912 8:133721618-133721640 CCTGCACACATTCCACTGCCTGG - Intergenic
1048451475 8:134537548-134537570 CCAGCACACAGCACACTGGCTGG - Intronic
1048859526 8:138713868-138713890 CCAGCACCCAGGATAGTGTCTGG - Intronic
1048922808 8:139246278-139246300 CCAGCACCAAGGACAGCGCCTGG + Intergenic
1049009306 8:139876614-139876636 CCAGCACTGAGGACAGTGCCTGG + Intronic
1049332983 8:142065027-142065049 CCTGGGCCCAGGACACTCCGTGG + Intergenic
1049514362 8:143045613-143045635 CCCCCACCCAGGACCCTCCCAGG + Intronic
1049545839 8:143230142-143230164 CCTGCACCCAGGTCCCTGACAGG + Intergenic
1049590930 8:143462141-143462163 GGGCCACCCAGGACACTGCCAGG + Intronic
1049807920 8:144549280-144549302 GCTGGACCCAGGACGCTGCCAGG + Intronic
1051581457 9:18680369-18680391 CCTCCACACAGGAAACTGCCCGG - Exonic
1051942626 9:22526984-22527006 TCTGCACCCAATACAATGCCTGG - Intergenic
1053015363 9:34658807-34658829 CCAGCACCCAGTACAAAGCCTGG - Intronic
1053174095 9:35909913-35909935 CCTGCCCCCAGCACAGGGCCAGG + Intergenic
1053177931 9:35942791-35942813 TCTGCAGTCAGGCCACTGCCTGG - Intergenic
1053270349 9:36745345-36745367 ACTGCAGCCAGGACTATGCCTGG - Intergenic
1053422046 9:37985870-37985892 CCAGGACACAGGACAGTGCCTGG - Intronic
1053445158 9:38146984-38147006 CCGGCACCCATGCCAGTGCCTGG + Intergenic
1054154340 9:61629552-61629574 TCAGCACCCAGCACAGTGCCTGG + Intergenic
1055597588 9:77881301-77881323 CAAGCACCCCGAACACTGCCTGG + Intronic
1055651246 9:78409418-78409440 CCTGCACTCAGCCCAGTGCCTGG - Intergenic
1056132152 9:83597504-83597526 CCAGCATCCAGAACAGTGCCTGG - Intergenic
1056786496 9:89596104-89596126 CCTCCACCCCGCACACTGCTGGG - Intergenic
1056974091 9:91234675-91234697 TCAGCACCTAGGACAGTGCCTGG - Intronic
1057440205 9:95077460-95077482 CATGCTCCCAGGACGGTGCCTGG - Intronic
1057785273 9:98082731-98082753 CCTGCTCCCAAGGTACTGCCTGG + Intronic
1058170545 9:101675519-101675541 CCAGCACCTAGGACAGTGCCTGG - Intronic
1058241701 9:102569947-102569969 CCTGAACCCAGCACAGTGCTGGG - Intergenic
1059327429 9:113512696-113512718 CCTGCACCCAGGACCCAGGCTGG + Intronic
1059923735 9:119186097-119186119 CCTGAGCCCAGGGCACTGCCTGG + Intronic
1060020526 9:120126546-120126568 CCAGCATCAAGAACACTGCCTGG - Intergenic
1060039413 9:120286843-120286865 CCAGCACCCAGCATAGTGCCTGG + Intergenic
1060059116 9:120443346-120443368 CCAGAACCCAGCCCACTGCCTGG + Intronic
1060198232 9:121636821-121636843 ACTGCACTCAGGAAGCTGCCTGG - Intronic
1060404880 9:123368245-123368267 CCTGTGCCCAGGAGCCTGCCAGG - Intronic
1060547979 9:124471759-124471781 CTGGCACCCAGCACAGTGCCTGG - Intronic
1061096380 9:128459203-128459225 GAAGCACCCAGGACAGTGCCTGG - Intronic
1061121057 9:128642626-128642648 CAGGCACCCAGGACCATGCCCGG - Intronic
1061140667 9:128764316-128764338 GCTGCACTCAGGACACTGCTGGG + Intronic
1061192097 9:129087975-129087997 CTTGCCCCCAGCACACAGCCTGG - Intronic
1061211537 9:129196325-129196347 CCTGTGCCCAGCACAGTGCCTGG + Intergenic
1061704666 9:132443880-132443902 TTTGCACCCACAACACTGCCTGG + Intronic
1061809685 9:133155077-133155099 CGTGCACACAGGACCCTGCTGGG - Intronic
1062254571 9:135614903-135614925 CCTGCACCCCTGCCTCTGCCTGG - Intergenic
1062380500 9:136284573-136284595 CCTGCACACCGCATACTGCCAGG - Intronic
1062456907 9:136644352-136644374 CCTGCCCGCGGGTCACTGCCAGG - Intergenic
1186540077 X:10391515-10391537 CCAGCACCCAGGATAGTGCCCGG + Intergenic
1186923878 X:14310678-14310700 CCAGCACCTAGAACAGTGCCTGG + Intergenic
1187948280 X:24447656-24447678 CCTGCTCTCTGGACACTGCTGGG - Intergenic
1189327470 X:40121522-40121544 CTGGCACCCAGGACAGTGCTTGG - Intronic
1189739780 X:44105911-44105933 CCTTTTCCCAGGACAATGCCTGG - Intergenic
1190493475 X:51005253-51005275 CCTTCACTCAGGACCCTTCCAGG + Intergenic
1190539842 X:51465861-51465883 CCAGCATCAAGGACACTGCCTGG - Intergenic
1190553450 X:51609520-51609542 CCAGCACCCATGACAGTGCCAGG + Intergenic
1190623905 X:52317457-52317479 CCAGCTCCTAGGACACTGCCTGG - Intergenic
1190736658 X:53259922-53259944 CCAGCACCCAGCACTGTGCCTGG - Intronic
1190740236 X:53283762-53283784 CCAGCACCGGGGACAGTGCCTGG - Intronic
1191784833 X:64906130-64906152 GCTTCCCCTAGGACACTGCCAGG - Intergenic
1192579624 X:72270347-72270369 CCTGCATCCAGGTGACTGGCTGG + Intronic
1192615859 X:72621377-72621399 TCAGCACCTAGTACACTGCCTGG - Intronic
1192803913 X:74493463-74493485 TCAGCACCCATGAGACTGCCAGG + Intronic
1192903312 X:75522952-75522974 CTGGCACCCAGGACAGTACCCGG + Exonic
1193135644 X:77968453-77968475 TCTGCAGTCAGGCCACTGCCTGG - Intronic
1194169603 X:90565025-90565047 CCTGCAACCAGGTCCCTGCCTGG - Intergenic
1195086745 X:101420399-101420421 TCAGCACCCAGTACAATGCCTGG - Intronic
1195871659 X:109492819-109492841 CATGCACTTAGGACAGTGCCTGG + Intergenic
1196762722 X:119214109-119214131 CCTGTACCTAGAACAGTGCCAGG + Intergenic
1197288083 X:124619956-124619978 TCTGCAATCAGGAGACTGCCTGG + Intronic
1197626959 X:128813015-128813037 CCAGCACCCAGCACAGTGTCTGG + Intergenic
1197717056 X:129717151-129717173 CCAGCACCTAGCACAGTGCCTGG + Intergenic
1198604797 X:138325105-138325127 TCTGCATCCAGTACTCTGCCCGG + Intergenic
1198666868 X:139034146-139034168 CCAGCACCTAGCACAGTGCCTGG - Intronic
1198776903 X:140189423-140189445 ACTGCACTCAGGACACAGCCAGG + Intergenic
1199456644 X:148036827-148036849 CAAGCACCCAGAACAGTGCCTGG - Intergenic
1199701573 X:150381293-150381315 CCTTCACCCAGTTCACAGCCAGG + Intronic
1200515841 Y:4142799-4142821 CCTGCAACCAGGTCCCTGCCTGG - Intergenic
1201896415 Y:18997293-18997315 CCTCCACCCAGACCCCTGCCAGG - Intergenic
1202389396 Y:24354599-24354621 CCAGCACCTAGAACAGTGCCTGG - Intergenic
1202481391 Y:25315520-25315542 CCAGCACCTAGAACAGTGCCTGG + Intergenic