ID: 1106552099

View in Genome Browser
Species Human (GRCh38)
Location 13:30780940-30780962
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106552099_1106552104 3 Left 1106552099 13:30780940-30780962 CCCCACCAGATCTCATATTGAAA No data
Right 1106552104 13:30780966-30780988 GATCTCCACTGTGGCTGTGTTGG No data
1106552099_1106552112 21 Left 1106552099 13:30780940-30780962 CCCCACCAGATCTCATATTGAAA No data
Right 1106552112 13:30780984-30781006 GTTGGGAGTTGGGGTCTGGTGGG No data
1106552099_1106552103 -6 Left 1106552099 13:30780940-30780962 CCCCACCAGATCTCATATTGAAA No data
Right 1106552103 13:30780957-30780979 TTGAAATTTGATCTCCACTGTGG No data
1106552099_1106552113 24 Left 1106552099 13:30780940-30780962 CCCCACCAGATCTCATATTGAAA No data
Right 1106552113 13:30780987-30781009 GGGAGTTGGGGTCTGGTGGGAGG No data
1106552099_1106552107 10 Left 1106552099 13:30780940-30780962 CCCCACCAGATCTCATATTGAAA No data
Right 1106552107 13:30780973-30780995 ACTGTGGCTGTGTTGGGAGTTGG No data
1106552099_1106552111 20 Left 1106552099 13:30780940-30780962 CCCCACCAGATCTCATATTGAAA No data
Right 1106552111 13:30780983-30781005 TGTTGGGAGTTGGGGTCTGGTGG No data
1106552099_1106552108 11 Left 1106552099 13:30780940-30780962 CCCCACCAGATCTCATATTGAAA No data
Right 1106552108 13:30780974-30780996 CTGTGGCTGTGTTGGGAGTTGGG No data
1106552099_1106552109 12 Left 1106552099 13:30780940-30780962 CCCCACCAGATCTCATATTGAAA No data
Right 1106552109 13:30780975-30780997 TGTGGCTGTGTTGGGAGTTGGGG No data
1106552099_1106552105 4 Left 1106552099 13:30780940-30780962 CCCCACCAGATCTCATATTGAAA No data
Right 1106552105 13:30780967-30780989 ATCTCCACTGTGGCTGTGTTGGG No data
1106552099_1106552110 17 Left 1106552099 13:30780940-30780962 CCCCACCAGATCTCATATTGAAA No data
Right 1106552110 13:30780980-30781002 CTGTGTTGGGAGTTGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106552099 Original CRISPR TTTCAATATGAGATCTGGTG GGG (reversed) Intergenic
No off target data available for this crispr